Разное

Энтеровирусная инфекция или ветрянка: Ветрянка или энтеровирус??? как определить? — 30 ответов на Babyblog

Содержание

Чем опасна турецкая ветрянка коксаки и как её выявить?

О серьёзности той или иной болезни дети судят, в основном, по уровню беспокойства мамы и папы. Три недели назад Виталик своих родителей перепугал не на шутку – состояние было очень тяжелым.

Я уже давно поправился!

Ребёнок, конечно, о своем недуге уже и забыл, а вот взрослые помнят хорошо. Лихорадка, сыпь, зуд — симптомы, которые вызывают самую серьёзную тревогу.

Кто-то называет синдром «рука-нога-рот»,  кто-то «ящероподобный синдром», но суть в том,  что у человека появляются высыпания в ротовой полости, бывают в области миндалин и высыпания на коже, чаще всего на ладонях и стопах.

Так проявляет себя один из энтеровирусов, который мы знаем как коксаки или турецкая лихорадка.  Впрочем, только Малой Азией этот вирус себя не ограничивает. Ареал его обитания широк: от Китая до Северной Америки.  В России до последнего времени он был редким гостем.

И именно поэтому узнать его в лицо способны не все участковые педиатры и терапевты.  Его легко спутать с герпетической инфекцией, ангиной, стоматитом и банальным гриппом.  Для постановки точного диагноза требуются дополнительные анализы, которые делают далеко не в каждой поликлинике. А между тем, поздняя диагностика чревата осложнениями.

Среди этой группы есть вирусы которые вызывают серозные менингиты. Если упорная головная боль, рвота, высокая температура, то врач принимает решение  о госпитализации. Есть осложнения, которые возникают со стороны сердца, почек, они возникают и на ранней степени заболевания. Поэтому лучше к врачу обратиться. 

Надо знать, что специфического лечения для коксаки, как и для большинства энтеровирусов, не существует. Лечение симптоматическое: жаропонижающее, антисептики для горла, антигистаминные — чтобы снизить реакцию кожных покровов, и помощь для кишечника. Если иммунитет в порядке, выздоровление наступает в течение первых 5 -7  дней.

А вот заразиться от человека, переболевшего коксаки,  можно ещё почти 2 месяца.  Как выяснилось, Виталик приобрёл экзотический вирус от своего старшего брата Артёма, побывавшего на отдыхе в Испании. 

У него поднялась температура. Мы решили, что это от перегрева. Было очень жарко. И всё бы ничего, но на следующий день у него появилась сыпь, температура прошла, держалась около суток, а потом появилась сыпь на стопах, на руках, немного на лице, немного по телу. Потом благополучно всё прошло и мы об этом забыли.

Лето — самый благоприятный сезон для энтеровирусов. А бассейны или тёплые моря  плюс  скопления людей — идеальные условия для распространения инфекции. Пути передачи коксаки- самые разнообразные. Это и воздушно-капельный, и контактный, и даже водный — вирус может попасть на слизистую вместе с водой, когда дети плавают в водоёмах. 

Профилактика турецкой лихорадки, как и любого энтеровируса— гигиена, гигиена и ещё раз гигиена. Мыть руки, мыть фрукты, а после купания не лишним будет прополоскать рот, так как вирус какое-то время остаётся на слизистых оболочках полости рта и горла. При любых подозрениях на энтеровирус — обязательно показаться врачу. Ну а  тем, кто переболел,  важно помнить, что риск передать инфекцию, особенно при контактах с маленькими детьми,  сохраняется длительное время. Будьте внимательны и берегите свое здоровье и здоровье своих  близких!  

В Новосибирске дети стали чаще болеть вирусом Коксаки | ЗДОРОВЬЕ

В сентябре 2021 года родители массово пожаловались на то, что их дети болеют вирусом Коксаки. Все они воспитанники детсадов, у них похожие симптомы — высокая температура и сыпь. Кому-то назначают даже тесты на коронавирус, а кому-то диагноз ставят на глаз.

Чаще всего жалуются на странную болезнь родители из Ленинского района. К примеру, сибирячка Анна не делала ребенку тестов, диагноз поставила сама по интернету. У ее ребенка температура 37,8 держалась только один день. Затем во рту появилась сыпь, а также на пятой точке, пальцах ног и рук.

Другая мама, Наталья, вызвала педиатра из поликлиники № 7, которая подтвердила предположения родительницы. Ребенок выздоровел за три дня.

У Маргариты заболел сын. Сначала у мальчика опух глаз, затем подскочила температура до 38,5. Ребенка собрались обследовать на коронавирус, приехала ковидная бригада из поликлиники № 27. У мальчика постоянно поднималась температура до 40. Врачи сказали сбивать ее. 

Утром у ребенка заболело горло и покрылось белым налетом. Врачи выписали антибиотик. К вечеру мальчик стал сильно чесаться — стопы, ладони. Появилась красная сыпь, как ветрянка. Ребенок кричал и плакал всю ночь. Позже врач подтвердил, что это вирус Коксаки.

Сибирячка Екатерина тоже заметила сыпь у ребенка на ногах и обратилась в частную клинику. Такие же волдыри были в горле. Семью положили в инфекционную больницу на Мочищенском шоссе, где подтвердили диагноз и назначили лечение. В частной клинике, по словам женщины, указали диагноз «Энтеровирусный везикулярный стоматит с экзантемой», в инфекционной больнице поставили диагноз «ОРВИ, острый ринофарингит средней степени тяжести, афтозный стоматит, вирусная экзантема».

У сибирячки Валентина девятилетний сын заболел, когда они были в Крыму. Болячки появились на ступнях и ладонях, вокруг них был сильный зуд, ребенок стал раздражительным. Врач из поликлиники №6 при осмотре подтвердила Коксаки.

Заведующая педиатрическим отделением многопрофильной клиники «1+1» Елена Кочергина сообщила, что вирус Коксаки относится к группе энтеровирусных инфекций. Болезнь протекает как без симптомов, так и с ними. Есть несколько форм вируса — герпесная ангина, миалгия, энтеровирусная экзантема и асептический серозный менингит (последний расценивается как осложнение). К врачам поликлиники чаще всего попадают пациенты с легкой или среднетяжелой формой. Сыпь длится от 2 до 4 дней. Чаще всего вирус Коксаки начинается с острой стадии — лихорадки до 40 градусов, головной боли, тошноты, рвоты, сыпи на слизистых во рту и теле, чаще всего на ладонях и стопах.

 

Педиатр высшей категории Наталья Садыкова отметила, что при ковиде сыпь бледная, а при Коксаки — яркая, с эрозиями. Причем появляется на ладонях и стопах. 

Врач-инфекционист, главный врач клинико-диагностической лаборатории ООО «Инвитро — Сибирь» Андрей Поздняков отметил, что энтеровирусная инфекция диагностируется по клиническим проявлениям. Чаще всего это типичная трехдневная лихорадка до 40 градусов. В зеве появляется герпетическая ангина, реже встречается жидкий стул. 

Главный врач Детской городской клинической больницы № 3 Татьяна Комиссарова отметила, что для установления диагноза надо сделать исследование, которое подтверждает наличие в носоглоточном смыве энтеровируса типа Коксаки определенного серотипа.

Чаще всего вспышки заболевания происходят летом. Заразиться можно через сырую воду, при купании. Другой способ заражения — контактно-бытовой, через грязные руки. Болеть могут не только дети, но и взрослые. 

В региональном Роспотребнадзоре отметили, что в 2021 году экстренных извещений от медучреждений заболевания жителей вирусом Коксаки не поступало. В 2020 году заболели всего два ребенка до 17 лет. А вот в 2019 году случаи энтеровирусной инфекции фиксировали ежемесячно, дети болели с третьей декады июня. В октябре количество случаев начало снижаться.

Минздрав региона подобную статистику заболеваемости не ведет. По данным Федеральной службы по надзору в сфере защиты прав потребителей и благополучия человека, неблагополучными по вирусу Коксаки являются 13 субъектов РФ, Новосибирская область в их число не входит, сообщает HГС.

Вирус Коксаки: симптомы и лечение

Вирус Коксаки является возбудителем синдрома «рука-нога-рот» (или энтеровирусный везикулярный стоматит с экзантемой) — симптомокомплекс, состоящий из поражения слизистой ротовой полости — энантемы и появления сыпи на верхних и нижних конечностях — экзантемы.

Инкубационный период с момента инфицирования до появления первых признаков синдрома длится четыре-семь дней.

Преимущественно вирус Коксаки проявляется нарушением работы кишечника, диареей, общей интоксикацией и характерной сыпью.

Течение инфекционного процесса в целом благоприятное, но бывают случаи развития осложнений.

Человек может заразиться от другого больного человека, а нередко — от вирусоносителя. Часто люди подхватывают инфекцию в отелях Турции, Кипра или в других местах отдыха. Передается вирус Коксаки, так же как и вирус гриппа, воздушно-капельным путем. Второй способ попадания в организм — алиментарный. Общая посуда, грязные руки могут стать источником заражения. Не исключено инфицирование от немытых фруктов и овощей. Наиболее вероятный способ попадания вируса в организм — через верхние дыхательные пути.

Вирус Коксаки — внутриклеточный паразит. Вначале вирусные частички накапливаются в слизистых оболочках и лимфоидной ткани носовой полости, глотки, тонкого кишечника. Затем он выходит в кровь и перемещается по кровяному руслу к разным органам. Распространяясь в организме, вирусные частицы оседают в различных органах, проникают в их клетки, где приводят к развитию воспалительного процесса.

Наибольшее количество вируса паразитирует в нервных клетках (нейроциты), поперечнополосатых мышцах, коже и внутренних органах (печень, почки). На последней стадии включается иммунная система, и ее Т-лимфоциты уничтожают вирус и зараженные им клетки.

В зависимости от преимущественной локализации вируса болезнь может развиваться в различных направлениях.

Гриппоподобная форма

Ее называют летним гриппом или трехдневной лихорадкой. Это самое легкое течение болезни. Признаки болезни очень похожи на ОРВИ. Период развития инфекции около трех-четырех дней. Температура тела может подняться до 39-40˚ С, но за короткое время все проходит без последствий, и ребенок выздоравливает.

Энтеровирусная экзантема

Главный отличительный признак этой формы — сыпь на руках, груди и голове. Появляющиеся пузырьки лопаются с образованием корок. На этих местах может шелушиться и отслаиваться кожа. Одновременно у ребенка повышается температура тела.

Это проявление болезни нередко путают с краснухой или ветряной оспой. Но проходит она, как и гриппоподобная форма, довольно быстро — от трех до пяти дней и без последствий.

Герпетическая ангина

Инкубационный период у такой инфекции одна-две недели. В этом случае вирус поражает слизистую глотки. Признаки заболевания: высокая температура, слабость, боль в горле. Хоть и назвали эту форму ангиной, симптомов привычной большинству формы тонзиллита не наблюдается. Состояние усугубляется головной болью. Могут увеличиться лимфоузлы и начаться насморк. В отличие от классической ангины, на слизистой миндалин и ротовой полости появляются пузырьки с жидкостью. Через некоторое время они лопаются. При осмотре можно наблюдать скопление маленьких эрозий, покрытых белым налетом. Болезнь даже больше похожа на стоматит, чем на ангину. Все симптомы проходят примерно через неделю.

Геморрагический конъюнктивит

Развивается молниеносно — от момента заражения до первых признаков проходит не более двух дней. Эта форма инфекции характеризуется ощущением песка в глазах, болью, светобоязнью, слезотечением, отечностью век, многочисленными кровоизлияниями, гнойными выделениями из глаз. Обычно вначале поражается один глаз, затем симптомы появляются и в другом глазу. При этом чувствует себя больной относительно неплохо. Болезнь продолжается в течение двух недель.

Кишечная форма

Симптомы типичные для кишечных инфекций: понос темного цвета (до восьми раз в сутки), рвота. Состояние усугубляется болью в животе, лихорадкой. У маленьких детей, кроме кишечной симптоматики, может начаться насморк, заболеть горло. Обычно диарея продолжается от одного до трех дней, полное восстановление кишечных функций происходит через 10-14 дней.

Полиомиелитоподобная форма

Все проявления как при полиомиелите. Но в отличие от него параличи развиваются молниеносно, не такие тяжелые, пораженные мышцы восстанавливаются быстро. При этой форме, как и при других, могут отмечаться все классические симптомы поражения вирусом Коксаки: сыпь, лихорадка, диарея.

Гепатит

Вирус Коксаки может атаковать клетки печени, которая увеличивается в размерах, отмечается чувство тяжести в правом боку.

Плевродиния

Болезнь проявляется в виде мышечных поражений. При оседании вируса в мышцах развивается миозит. Боль отмечается в разных частях тела. Очень часто болезненные проявления локализуются в межреберных мышцах. В этом случае может затрудняться дыхание, однако плевра не повреждается. При ходьбе или выполнении каких-то других движений боли усиливаются. Обычно они носят волнообразный характер (повторяются через определенный промежуток времени). Эта форма встречается довольно редко.

Нарушения в работе сердца

Могут развиться эндокардит, перикардит, миокардит. Отмечаются боль в груди, слабость. Болезнь развивается при заражении вирусами типа В. Очень тяжелая форма. Может понизиться артериальное давление, повыситься температура, ребенку постоянно хочется спать. Также часты проявления тахикардии, одышки, аритмии, отеков и увеличения печени.

Серозный менингит

По-другому этот вид менингита называют вирусным, так как возникает в результате вирусного поражения. Вызывать его могут различные вирусы, в том числе и вирус Коксаки.

В основном инфицирование вирусом Коксаки проходит без осложнений. Но в некоторых случаях заболевание имеет последствия.

На сегодняшний день вакцины от вируса Коксаки, впрочем, как и от других энтеровирусов, не получено. Единственная профилактика — соблюдение личной гигиены. Желательно, чтобы ребенок меньше бывал в людных местах, особенно в эпидемический период.

Материал подготовлен на основе информации открытых источников

Энтеровирусная инфекция или вирус Касаки: oncobudni — LiveJournal

pastoral2 (pastoral2) wrote in oncobudni,
Categories: Решила наваять ещё пост из своей новой бабушкиной жизни. Поскольку я последние лет этак 25 не пересекалась с детьми, забыла, что они болеют всякими инфекциями и вирусами и из сада их приносят, так вот, сидела я тут намедни с Макаром в выхи, а у него на личике и ручках были красные пятна, Валя сказала у него такое часто от сладкого, типа дерматит. Ну ладно, потом он заболевает, но почти без симптомно, небольшая температура, горло, и высыпания пошли по рукам и по лицу интенсивные.три врача так и не определились с диагнозом, все спорили ветрянка это или не ветрянка. Хотя картина разная совершенно и по виду высыпаний и по местам, потом сын заболел горло и температура, горло болело долго, поставили герпиоидную ангину, Валя невестка не болела, зато мы с братом свалились одновременно, высочайшая температура, через день высыпания, у брата на кистях, на внутренней стороне бедер и на лице, у меня во рту, боль адская, я пила через трубочку неделю только холодное и жидкое, это примерно как при остром стоматите. Главное, что очень заразная штука, она передается через вещи, руки, дверные ручки и воздушно капельным путём. Нам этот диагноз поставил инфекционист. Лечение симптоматическое. Почему пишу так развернуто, чтобы бабушки наши знали и вообще все, я лично об этой заразе узнала впервые. Всем здоровья!
  • Рецидив трипл

    Приветствую участников чата, и искренне желаю крепкого здоровья!!! Хочу узнать может быть у кого то похожий случай, как лечились, какие результаты? У…

  • Рак яичников,канцероматоз

    Здравствуйте,меня зовут Юля,мне 28 лет и онкологией болеют мои две самые любимые женщины на свете( Мама и Бабушка). На данный момент я нахожусь в…

  • Все что надо знать онкопациенту про показатели крови

    В новом подкасте Яны Седовой онколог Андрей Гардашников подробно в деталях рассказывает о теме, которая касается всех, кто проходит онкологическое…

  • Remove all links in selection

    Remove all links in selection

    {{ bubble.options.editMode ? ‘Save’ : ‘Insert’ }}

    {{ bubble. options.editMode ? ‘Save’ : ‘Insert’ }}

Photo

Hint http://pics.livejournal.com/igrick/pic/000r1edq

Под какими диагнозами прячется COVID-19 — Реальное время

Новая коронавирусная инфекция может скрываться в официальной статистике, в том числе и в графе «острые инфекции верхних дыхательных путей»

Фото: Илья Репин

Официальная статистика заболеваемости населения Татарстана показала необъяснимый рост острых инфекций верхних дыхательных путей — наиболее ощутимо в июне 2020 года, чуть ли не вдвое, по сравнению с тем же месяцем годом ранее. «Реальное время» выяснило: совсем не исключено, что этот прирост дал «ковид». А значит, реальные цифры заболеваемости в республике могут быть куда выше, чем ежедневно оглашаемые скованным федеральными стандартами татарстанским Минздравом.

Нетипичный июнь

Аналитическая служба «Реального времени» изучила отчеты Татарстанстата по заболеваемости населения за первые полгода 2020-го — и обнаружила странный подъем количества острых инфекций верхних дыхательных путей. Самый резкий скачок произошел в июне относительно того же периода 2019 и 2018 годов. Так, на экваторе нынешнего лета такими инфекциями болели 47 002 татарстанца, тогда как июнь-2019 показал 26 827 случаев, а июнь-2018 — и вовсе 23 608.

Правда, статистика за полугодие вполне благостная: роста заболеваемости за шесть месяцев в совокупности не обнаружено. Есть даже незначительное снижение — на 3,7 процентных пункта в абсолютных значениях и на 4,2 п.п. в пересчете на 100 тысяч человек. Все дело в том, что в апреле и особенно мае заболеваемость была существенно ниже, чем в предыдущие годы. Это объясняется просто: пока люди сидели на самоизоляции, они и к докторам реже обращались (а значит, и в статистику не попадали), да и подхватывали всевозможные ОРВИ куда менее интенсивно, чем обычно. Много ли подхватишь, выходя только в магазин, соблюдая строжайший масочно-перчаточный режим?

Кстати, статистику снижения количества всех инфекций на рекордные 22% за полгода приводила еще в июле Любовь Авдонина, заместитель руководителя Управления Роспотребнадзора по РТ. Тогда она говорила, что необходимость мыть руки, носить маски и самоизолироваться уменьшила заболеваемость кишечными инфекциями на 36%, энтеровирусными — на 30%, ветрянкой — на 25%, сальмонеллезом — на 14%, туберкулезом — на 12%.

Таким образом, даже почти 100%-ный июньский взлет заболеваемости инфекциями верхних дыхательных путей не смог сильно испортить общую статистическую картину полугодия. Но он вызывает вопрос: не «затесался» ли коронавирус, пик которого в Татарстане наблюдался незадолго до этого, в эту безобидную на первый взгляд графу?

«Высока вероятность того, что все-таки это был «ковид»

Халит Хаертынов, главный внештатный специалист Минздрава Татарстана по инфекционным болезням, в беседе с «Реальным временем» стопроцентно эту гипотезу подтверждать не стал, но утверждает, что, скорее всего, она верна:

— По-видимому, это так. Однозначно утверждать я этого не могу, но обычно подъем заболеваемости ОРВИ отмечается в холодное время года. Такой рост для мая или июня нелогичен. Он объясним в сентябре — октябре и необъясним для теплых месяцев года. С учетом того, что рост заболеваемости был отмечен как раз в период эпидемии коронавируса, скорее всего, он был связан именно с этой инфекцией. Потому что когда летом отмечается подъем заболеваемости ОРВИ, то сразу возникают сомнения в том, что это какие-то классические болезни. Высока вероятность того, что все-таки это был «ковид».

Обычно подъем заболеваемости ОРВИ отмечается в холодное время года. Фото Олега Тихонова

По словам Халита Саубановича, обычное среднестатистическое лето скорее дает всплеск кишечных или природно-очаговых инфекций (например, геморрагическую лихорадку с почечным синдромом), нежели острых респираторных заболеваний. Кстати, июньская статистика по кишечным инфекциям с неустановленным возбудителем прямо-таки радует глаз: всего 140 зарегистрированных случаев. В июне 2019-го их было 549, а в 2018 году — 506. Благодарить за такое резкое улучшение, судя по всему, нужно закрытые точки общепита и общий «изоляционный фон» начала лета.

Как «шифруется» коронавирус?

Инфекционист объясняет, как коронавирус «зашифровывается» под остальные типы респираторных инфекций:

— Коронавирусная инфекция может протекать с поражением верхних дыхательных путей, но без пневмонии, а может — с пневмонией. Поэтому в тех случаях, когда пневмонии нет и возбудитель не выделяется лабораторным способом, медики ставят диагноз ОРВИ. То есть в случае протекания коронавирусной инфекции в виде ОРВИ при отсутствии выделения возбудителя это и будет шифроваться как ОРВИ.

РНК вируса, по словам Хаертынова, выделяется далеко не во всех случаях заболевания. Диагностика коронавируса проводится методом ПЦР и методом компьютерной томографии. Но тонкости есть и здесь.

— Есть два варианта шифрования коронавирусной инфекции — первый, когда вирус выделяется, и тогда ставится диагноз «коронавирусная инфекция, подтвержденная выделением вируса». Второй вариант — когда диагноз ставится, но он неподтвержденный, без выделения вируса. Это происходит, когда есть клинические проявления (например, снижение сатурации или одышка), есть изменения на компьютерной томограмме, характерные для этой инфекции. В этом случае мы ставим коронавирусную инфекцию неподтвержденную.

И в этом нет никаких противоречий: дело в том, что стопроцентно подтвержденный диагноз COVID-19 медики могут поставить только если есть результаты лабораторных исследований. Только по клинической картине диагноз ставится в случае, например, гриппа и некоторых формах аденовирусных инфекций. Все остальные респираторно-вирусные заболевания, вызванные двумя сотнями разных возбудителей (в число которых входит и коронавирус) однозначно диагностируются только в лаборатории.

Диагностика коронавируса проводится методом ПЦР и методом компьютерной томографии. Фото gkb81.ru

Вирус исчезает к десятому дню заболевания

Диагноз, по словам инфекциониста, очень сложно однозначно поставить, если есть клинические проявления, но изменений на томограмме нет, а вирус в мазках не выделяется. Это вполне может быть COVID, протекающий в легкой респираторной форме — и тогда человек не попадает в провизорный госпиталь, не проходит ПЦР-тестов и с большой вероятностью попадет в ту самую графу, которая нас заинтересовала.

Под общим названием «острые инфекции верхних дыхательных путей» скрывается целый пласт симптоматических болезней — это все, что связано с насморком, заложенностью носа, болью в горле. В их числе, например, риниты, ринофарингиты, назофарингиты, ларингиты.

Решающее значение в диагностике для российских медиков имеет метод ПЦР. Он будет положительным с первых дней заболевания, в отличие от теста на антитела, которые начинают вырабатываться примерно на пятый день болезни. Правда, бывают и ложноотрицательные результаты ПЦР-теста. Халит Саубанович затруднился привести официальные цифры того, насколько часто возникают такие ошибки, — есть разные данные, которые сильно колеблются от источника к источнику.

В большей степени такие тесты направлены на установление самого факта инфекционного заболевания у человека. Фото Максима Платонова

— А что касается определения антител, то оно имеет вспомогательное, не основное значение. В большей степени такие тесты направлены на установление самого факта инфекционного заболевания у человека. Есть разные классы антител. Есть иммуноглобулины класса М, и есть — класса G. Иммуноглобулины класса М вырабатываются первыми, и если эти антитела выявляются, это свидетельствует об острой фазе заболевания. А если процесс уже старый, прошло больше двух недель, то должны быть уже иммуноглобулины класса G, и это говорит о перенесенной инфекции.

Кстати, сам вирус, по словам доктора, исчезает у человека примерно к десятому дню заболевания, поэтому при нетяжелой форме заболевания примерно двух недель достаточно, чтобы человек полностью поправился.

С этим может быть связано, например, то, что антитела (в том числе и класса М) к «ковиду» у человека выявляются при анализе, а РНК вируса — уже нет. Он еще болеет, но уже в неактивной фазе, поэтому ПЦР-тест наличия вируса не показывает — а значит, и в коронавирусную статистику не попадает.

Людмила Губаева

ОбществоМедицина Татарстан Управление Роспотребнадзора по Республике ТатарстанАвдонина Любовь Геннадьевна

Энтеровирус у детей: симптомы и лечение

Содержание:

Причины заболеванияКлассификация

Энтеровирусные инфекции – это группа заболеваний, провоцируемых вирусами из семейства пикорнавирусов. Характерными признаками для всех форм патологии являются повышение температуры, покраснение лица, шеи и рук. Но у каждой формы заболевания есть свои специфические проявления.

Причины заболевания

Энтеровирусную инфекцию могут вызывать вирусы Коксаки A/B, ЕСНО и другие виды энтеровирусов. Все эти микроорганизмы устойчивы к низким температурам, но быстро погибают при термической обработке, при воздействии хлора и йода.

Возбудители энтеровирусных инфекций у детей – энтеровирусы из семейства пикорнавирусов

Передача вируса происходит от человека-носителя несколькими путями: воздушно-капельным, фекально-оральным или трансплацентарным – от материнского организма плоду. Также заражение может произойти при употреблении сырой воды, через игрушки.

Но заболевание может и не развиться. Это зависит от нескольких факторов:

  • состояния иммунитета человека;
  • способности микроорганизма противостоять иммунной системе;
  • контагиозности – степени заразности вируса и способности влиять на организм человека.

В организм новорожденных вместе с материнским молоком попадают антитела к энтеровирусам, формируя иммунитет. Но он исчезает почти сразу после прекращения кормления грудью. Таким образом, заболевание развивается в основном у детей 2–10 лет. У взрослых заболевание встречается реже, так как у них иммунитет сформировался при бессимптомном протекании инфекции.

Классификация

Энтеровирусные инфекции могут быть двух типов – типичными и нетипичными. Первые вызывают ангину, гастроэнтерит, гепатит и другие патологии. При типичных инфекциях может произойти следующее:

  • нарушения функций нервной системы;
  • поражение сердечной мышцы;
  • глазные патологии;
  • поражение органов малого таза.

Нетипичные формы инфекций характеризуются стертым затяжным течением. К ним относят увеит, панкреатит, нефрит и другие.

По степени тяжести выделяют еще одну классификацию. Заболевание может иметь легкую, среднюю и тяжелую степень.

Симптомы 

Вирус проникает в детский организм в процессе дыхания. Микроорганизм попадает в лимфоузлы, оседает в них и начинает быстро размножаться. С момента проникновения вируса в организм и до возникновения первых симптомов может пройти 1–10 дней.

Все формы болезни начинаются остро и внезапно. Температура тела поднимается до 38–39 градусов. Она может быть постоянной и держаться 3–5 дней или волнообразной – несколько дней не проходит, затем исчезает на сутки, а потом снова появляется. Также наблюдаются и дополнительные признаки – увеличение лимфоузлов на шее, гиперемия кожи, головокружение, вялость и другие.

В зависимости от того, какой орган поражен энтеровирусом у детей, может встречаться несколько форм заболевания, которые сопровождаются особыми проявлениями:

  • энтеровирусная ангина, когда вирус поражает ротоглотку. На слизистых рта, глотки и миндалин появляется пузырчатая сыпь. Со временем эти пузырьки разрываются, а на их месте образуются язвочки с гнойным налетом;
  • конъюнктивит. В этом случае энтеровирус у детей поражает один или оба глаза. Наблюдаются слезотечение, боязнь света, покраснение глазного яблока и другие признаки;
  • миозит – поражение мышц. Сопровождается мышечной слабостью и болями. Степень дискомфорта зависит от температуры тела – когда она повышается, то появляются и боли. Но с ее понижением они исчезают;
  • энтерит – поражение слизистой кишечника. Для такой формы заболевания характерны нарушения стула. Наблюдается диарея, но при этом фекалии имеют нормальную окраску и не содержат примесей крови или слизи;
  • энтеровирусы могут поражать разные отделы сердца, вызывая миокардит, эндокардит или перикардит. Такие заболевания сопровождаются скачками АД, болями под левой лопаткой и за грудиной, изменением сердечного ритма;
  • поражение нервной системы вызывает энцефалиты, менингиты. При таких заболеваниях наблюдаются головные боли, предобморочные состояния и другие признаки;
  • гиперемия – кожное поражение. Сопровождается красной сыпью на коже головы, рук и груди;
  • орхит – воспаление яичек у мальчиков. Наблюдается на фоне других форм заболевания. Обычно проходит без последствий, но иногда приводит к аспермии в половозрелом возрасте. Из-за этого мужчина будет бесплодным;
  • внутриутробное заражение плода может привести к выкидышу или развитию у малыша синдрома внезапной смерти, когда он погибает на фоне полного здоровья.

Может быть изолированное поражение или комбинированное, когда одновременно наблюдается сразу несколько форм заболевания.

Один из симптомов энтеровирусной инфекции – красная сыпь

Диагностика

Поражение энтеровирусом диагностируется на основе специфических признаков. Но для уточнения диагноза назначаются дополнительные методы исследования – иммуногистохимический, серологический, молекулярно-биологический, культуральный. Проводятся лабораторные исследования биологических жидкостей – крови, смывов из носоглотки и других.

Учитывая ведущий симптом заболевания, может потребоваться консультация педиатра, кардиолога, невролога, офтальмолога и прочих специалистов. Необходимо дифференцировать болезнь от других патологий – кори, скарлатины, полиомиелита, ОРВИ.

Лечение

При легких формах заболевания допускается терапия в амбулаторных условиях. Ребенку рекомендуется соблюдать постельный режим все время, пока у него наблюдается повышенная температура.

Необходимо скорректировать питание больного. Оно должно быть легким, содержать минимум 50% белковой пищи – мясо, бобовые, яйца и другие. Если у ребенка энтерит, в рацион включают сухарики из белого хлеба, супы с консистенцией пюре или киселя, фрикадельки из нежирного мяса, кашу на воде, рыбу, вареные яйца, фруктовое желе. Рекомендовано обильное питье. Необходимо исключить молочные продукты, сырые овощи и фрукты, специи, жирные и жареные блюда.

Назначается симптоматическое лечение с применением противовирусных и жаропонижающих средств. Проводится дезинтоксикационная терапия, полоскание рта и орошение носа.

На весь период лечения ребенка нужно изолировать. Запрещается посещение детского сада или школы. Энтеровирусы очень легко передаются, поэтому возможны эпидемии. Возвращать ребенка в детский коллектив можно только после исчезновения всех проявлений.

При тяжелом течении заболевания рекомендуется лечение в условиях стационара. Показаниями к этому являются стойкая температура, поражение жизненно важных органов, параличи. В таких случаях терапия включает прием интерферонов, иммуноглобулинов, глюкокортикостероидов.

Лечение энтеровирусных инфекций у детей можно проводить амбулаторно

Профилактика

Специальная вакцина против энтеровирусной инфекции не разработана, так как заболевание вызывается огромным количеством серотипов вирусов. Чтобы предотвратить развитие патологии, необходимо придерживаться следующих рекомендаций:

  • стараться не контактировать с заболевшими людьми. В сезон простуд не посещать людные места;
  • следить за собственной гигиеной. Мыть руки после каждого пребывания на улице, после взаимодействия с больными людьми или животными, перед приемом пищи. Если нет возможности сразу вымыть руки, их нужно хотя бы обработать влажными салфетками;
  • каждый член семьи должен иметь свою зубную щетку и полотенце для лица;
  • регулярно убирать в доме с использованием дезинфицирующих средств, не допускать скопления пыли на поверхностях. Раз в неделю проводить генеральную уборку;
  • каждый день проветривать все помещения в доме;
  • пить только кипяченую или фильтрованную воду. При покупке воды в магазине нужно следить, чтобы емкость была хорошо запечатанной, иначе в ней могут скопиться бактерии. При открытии бутылки должен быть характерный звук шипения;
  • взрослые должны соблюдать «респираторный этикет», этому же нужно научить и детей. Он заключается в прикрывании рта рукой или салфеткой при чихании/кашле. После этого салфетку необходимо выбросить в урну, а руки тщательно вымыть с мылом;
  • не рекомендуется купаться в открытых водоемах, так как они могут быть загрязнены бактериями;
  • в сезон простуд запрещается посещать бани, сауны, бассейны;
  • не покупать пищевые продукты на рынке. Перед употреблением свежих овощей и фруктов их необходимо тщательно вымыть под проточной водой, а после этого обдать кипятком. Желательно употреблять только термически обработанные продукты;
  • запрещается самолечение любых заболеваний. Это может привести к их хронизации, иммунитет будет постоянно сниженным, и организм станет восприимчивым к вирусному поражению.

Вышеперечисленные рекомендации являются профилактикой не только энтеровирусных инфекций, но и других вирусных заболеваний. Соблюдая их, можно защитить себя и своих близких от болезней.

Энтеровирусные инфекции обычно не вызывают серьезных последствий для организма, если вовремя начать их терапию. После того как ребенок перенес заболевание, у него появляется иммунитет к энтеровирусам. В дальнейшем заболевание возникнуть не должно или будет протекать в легкой форме.

Читайте в следующей статье: краснуха у детей

Видео

энтеровирусов | Болезнь или состояние недели

Большинство людей, инфицированных неполиомиелитными энтеровирусами, не болеют или болеют только в легкой форме. Симптомы легкой болезни могут включать жар, насморк, чихание, кашель, кожную сыпь, волдыри во рту, а также боли в теле и мышцах. Три наиболее распространенных типа неполиомиелитных энтеровирусов — это энтеровирус D68 (EV-D68), энтеровирус A71 (EV-A71) и вирус Коксаки (CV) -A6. Инфекции, вызванные энтеровирусами, не относящимися к полиомиелиту, распространены в Соединенных Штатах летом и осенью.CDC не может предсказать, какой тип энтеровируса будет более распространенным в каждый сезон, потому что каждый год циркулирует смесь различных типов энтеровирусов, и разные типы могут быть обычными в разные годы.

Викторина

Ключевые факты

  • Легкие симптомы энтеровирусной инфекции могут включать жар, насморк, чихание, кашель, кожную сыпь, волдыри во рту, а также боли в теле и мышцах.
  • Дети, страдающие астмой, особенно подвержены риску серьезных симптомов энтеровирусной инфекции.
  • Специфического лечения энтеровирусных инфекций не существует.
  • Самое важное, что вы можете сделать, чтобы оставаться здоровым, — это часто мыть руки с мылом в течение не менее 20 секунд.

Медиа

Защитите свою семью

Часто мойте руки водой с мылом в течение 20 секунд. Также не прикасайтесь к глазам, носу и рту немытыми руками, прикрывайте кашель и чихание салфеткой или рукавом рубашки, а не руками.

Дети с астмой

Дети с астмой особенно подвержены риску тяжелых симптомов энтеровирусной инфекции.Обсудите и обновите план действий вашего ребенка по лечению астмы со своим врачом.

Лечение энтеровирусов

Лечения энтеровирусных инфекций не существует. Поговорите со своим врачом о том, как лучше всего контролировать симптомы.

Распространенность EV-D68

Хотя 2014 год был большим годом для вспышек EV-D68, которые были обнаружены в период с августа по ноябрь в 2014, 2016 и 2018 годах, CDC не может предсказать, будет ли EV-D68 распространенным типом энтеровируса. в будущих сезонах.

Советы по профилактике

  • Часто мойте руки водой с мылом в течение не менее 20 секунд.
  • Не прикасайтесь к глазам, носу и рту немытыми руками.
  • Избегайте близких контактов, таких как поцелуи, объятия и совместное использование чашек или столовых приборов, с больными людьми.
  • При кашле и чихании прикрывайте салфеткой или рукавом рубашки, а не руками.
  • Очищайте и дезинфицируйте поверхности, к которым часто прикасаются, такие как игрушки, дверные ручки и сотовые телефоны, особенно если кто-то болен.
  • Оставайтесь дома, когда вы больны, и не позволяйте больным детям посещать школу.

Энтеровирусы: основы практики, история вопроса, патофизиология

  • Рашид М., Хан М.Н., Джалбани Н. Обнаружение аденовируса человека, ротавируса и энтеровируса в водопроводной воде и их связь с общим качеством воды в Карачи, Пакистан. Еда Среда Вирол . 2021 марта, 13 (1): 44-52. [Медлайн].

  • Kogon A, Spigland I, Frothingham TE, Elveback L, Williams C, Hall CE. Программа наблюдения за вирусами: постоянное наблюдение за вирусными инфекциями в семьях столичного Нью-Йорка.VII. Наблюдения за вирусной экскрецией, сероиммунитетом, внутрисемейным распространением и ассоциацией болезней при инфекциях Коксаки и эховирусах. Am J Epidemiol . 1969, январь, 89 (1): 51-61. [Медлайн].

  • Кох В.М., Богич Т., Сигел К., Джин Дж., Чонг Е.Ю., Тан С.Й. и др. Эпидемиология болезней рук, ящура и рта в Азии: систематический обзор и анализ. Педиатр Инфекция Дис. J . 2016 г. 3 июня [Medline].

  • Smith WG. Миоперикардит Коксаки B у взрослых. Сердце J . 1970 Июль 80 (1): 34-46. [Медлайн].

  • Koontz CH, Ray CG. Роль вирусных инфекций Коксаки группы B в спорадическом миоперикардите. Сердце J . 1971 декабрь 82 (6): 750-8. [Медлайн].

  • Коно Р., Учида Ю. Острый геморрагический конъюнктивит. Офтальмол раскоп . 1977. 39:14.

  • Рорабо М.Л., Берлин Л.Е., Хелдрих Ф. и др. Асептический менингит у детей младше 2 лет: острые заболевания и неврологические осложнения. Педиатрия . 1993 августа 92 (2): 206-11. [Медлайн].

  • Модлин Дж. Ф., Даган Р., Берлин Л. Е., Виршуп Д. М., Йолкен Р. Х., Менегус М. Очаговый энцефалит с энтеровирусными инфекциями. Педиатрия . 1991 Октябрь 88 (4): 841-5. [Медлайн].

  • Quartier P, Debre M, De Blic J, et al. Ранняя и длительная внутривенная заместительная терапия иммуноглобулином при детской агаммаглобулинемии: ретроспективный опрос 31 пациента. Дж. Педиатр .1999 Май. 134 (5): 589-96. [Медлайн].

  • Мельник JL. Открытие энтеровирусов и классификация среди них полиовирусов. Биологические препараты . 1993 21 декабря (4): 305-9. [Медлайн].

  • Оберсте М.С., Махер К., Килпатрик Д.Р., Флемистер М.Р., Браун Б.А., Палланш М.А. Типирование энтеровирусов человека путем частичного секвенирования VP1. Дж. Клин Микробиол . 1999 Май. 37 (5): 1288-93. [Медлайн]. [Полный текст].

  • Oberste MS, Maher K, Michele SM, Belliot G, Uddin M, Pallansch MA. Энтеровирусы 76, 89, 90 и 91 представляют новую группу внутри вида Human enterovirus A. J Gen Virol . 2005 Февраль 86: 445-51. [Медлайн].

  • Оберсте М.С., Махер К., Никс В.А. и др. Молекулярная идентификация 13 новых типов энтеровирусов, EV79-88, EV97 и EV100-101, представителей вида Human Enterovirus B. Virus Res . 2007 сентябрь 128 (1-2): 34-42. [Медлайн].

  • Rueckert RR. Picornaviridae и их размножение.Филдс Б.Н., Книпе Д.М., ред. Вирусология . 2-е изд. Нью-Йорк: Raven Press; 1990. 507.

  • Коуч Р.Б., Дуглас Р.Г. младший, Линдгрен К.М., Герон П.Дж., Найт В. Передача респираторной инфекции с помощью вируса Коксаки А типа 21 воздушно-капельным путем. Am J Epidemiol . 1970, январь, 91 (1): 78-86. [Медлайн].

  • Онорато И. М., Моренс Д.М., Шонбергер Л.Б., Хэтч М.Х., Камински Р.М., Тернер Дж. Острый геморрагический конъюнктивит, вызванный энтеровирусом типа 70: ​​эпидемия в Американском Самоа. Ам Дж. Троп Мед Хиг . 1985 сентябрь 34 (5): 984-91. [Медлайн].

  • Вольф Дж.Л., Рубин Д.Х., Финберг Р. и др. Кишечные М-клетки: путь проникновения реовируса в хозяина. Наука . 1981, 24 апреля. 212 (4493): 471-2. [Медлайн].

  • Хорстманн Д.М., Макколлум Р.В. Вирус полиомиелита в крови человека при легком течении болезни и бессимптомной инфекции. Proc Soc Exp Biol Med . 1953 Март 82 (3): 434-7. [Медлайн].

  • Minor PD, John A, Ferguson M, Icenogle JP.Антигенная и молекулярная эволюция вакцинного штамма полиовируса типа 3 в период выделения первичным вакцинированным. Дж. Gen Virol . 1986, апр. 67 (Pt 4): 693-706. [Медлайн].

  • Rose NR, Wolfgram LJ, Herskowitz A, Beisel KW. Постинфекционный аутоиммунитет: две отдельные фазы миокардита, вызванного вирусом Коксаки В3. Энн Н. Ю. Акад. Наук . 1986. 475: 146-56. [Медлайн].

  • Огра ПЛ, Карзон ДТ. Образование и функция антител к полиовирусу в различных тканях. Прог Мед Вирол . 1971. 13: 157.

  • Torfason EG, Reimer CB, Keyserling HL. Ограничение подкласса антител к энтеровирусу человека. Дж. Клин Микробиол . 1987 25 августа (8): 1376-9. [Медлайн]. [Полный текст].

  • Рейджер-Зисман Б., Эллисон А.С. Роль антител и клеток-хозяев в устойчивости мышей к инфекции вирусом Коксаки B-3. Дж. Gen Virol . 1973 июн.19 (3): 329-38. [Медлайн].

  • Центры по контролю и профилактике заболеваний. Эпиднадзор за энтеровирусами — США, 2000-2001 гг. MMWR Morb Mortal Wkly Rep . 2002 г. 22 ноября. 51 (46): 1047-9. [Медлайн].

  • Икеда Т., Мизута К., Абико С., Аоки Ю., Итагаки Т., Кацусима Ф. и др. Острые респираторные инфекции, вызванные энтеровирусом 68, в Ямагате, Япония, с 2005 по 2010 год. Микробиол Иммунол . 2012 Февраль 56 (2): 139-43. [Медлайн].

  • Cortese MM, Kambhampati AK, Schuster JE, Alhinai Z, Nelson GR, Guzman Perez-Carrillo GJ, et al. Десятилетняя ретроспективная оценка острого вялого миелита в 5 педиатрических центрах США, 2005-2014 гг. PLoS Один . 2020.15 (2): e0228671. [Медлайн].

  • Элрик М.Дж., Пекош А., Дуггал П. Энтеровирус D68 Молекулярная и клеточная биология и патогенез. Дж Биол Химия . 2021 20 января. 100317. [Medline].

  • Biggs HM, Nix WA, Zhang J, Rogers S, Clara W., Jara JH и др. Инфекция энтеровирусом D68 среди госпитализированных детей с тяжелым острым респираторным заболеванием в Сальвадоре и Панаме, 2012-2013 гг. Другие респирные вирусы гриппа . 2021, 15 марта (2): 181-187. [Медлайн].

  • Xiang Z, Xie Z, Liu L, Ren L, Xiao Y, Paranhos-Baccalà G и др. Генетическая дивергенция энтеровируса D68 в Китае и США. Научный сотрудник . 2016 г. 9 июня: 27800. [Медлайн].

  • Энтеровирус D68. Центры по контролю и профилактике заболеваний. Доступно по адресу http://www. cdc.gov/non-polio-enterovirus/about/EV-D68.html?s_cid=cdc_homepage_whatsnew_001. Доступ: 11 сентября 2014 г.

  • Foster CB, Coelho R, Brown PM, Wadhwa A, Dossul A, Gonzalez BE и др. Сравнение госпитализированных детей с энтеровирусом D68 и детей с риновирусом. Пульмонол Педиатр .30 января 2017 г. [Medline].

  • Липсон С.М., Уолдерман Р., Костелло П. Чувствительность культур клеток эмбрионов рабдомиосаркомы и морских свинок к полевым изолятам трудно культивируемых вирусов Коксаки группы А. Дж. Клин Микробиол . 1986. 26: 1298.

  • Всемирная организация здравоохранения — Региональное бюро для Восточного Средиземноморья. Эпиднадзор за ОВП, Еженедельный бюллетень по факсу полиомиелита. Всемирная организация здравоохранения — Региональное бюро для Восточного Средиземноморья .07.09.2009.

  • Центр по контролю и профилактике заболеваний. Глобальная программа ликвидации полиомиелита. CDC . Июль 2009г.

  • Глобальная инициатива по ликвидации полиомиелита. Еженедельный обзор дикого полиовируса. 8 сентября 2009 г. Доступно на http://www.polioeradication.org/casecount.asp.

  • Ким Х.Дж., Кан Б., Хван С., Хонг Дж., Ким К., Чхон Д.С. Эпидемии вирусного менингита, вызванного эховирусом 6 и 30, в Корее в 2008 г. Virol J .2012 15 февраля, 9:38. [Медлайн]. [Полный текст].

  • Bubba L, Broberg EK, Jasir A, Simmonds P, Harvala H, соавторы исследования энтеровируса. Циркуляция неполиомиелитных энтеровирусов в 24 странах ЕС и ЕЭЗ в период с 2015 по 2017 год: ретроспективное эпиднадзорное исследование. Ланцет Инфекция Дис . 2020 марта 20 (3): 350-361. [Медлайн].

  • Fairweather D, Frisancho-Kiss S, Njoku DB, Nyland JF, Kaya Z, Yusung SA. Дефицит рецепторов комплемента 1 и 2 увеличивает индуцированный вирусом Коксаки В3 миокардит, дилатационную кардиомиопатию и сердечную недостаточность за счет увеличения макрофагов, IL-1beta и отложения иммунных комплексов в сердце. Дж Иммунол . 2006 15 марта. 176 (6): 3516-24. [Медлайн].

  • Curnen EC, Shaw EW, Melnick JL. Заболевание, напоминающее непаралитический полиомиелит, связанное с вирусом, патогенным для детенышей мышей. J Am Med Assoc . 1949 26 ноября, 141 (13): 894-901. [Медлайн].

  • Weller TH, Enders JF, Buckingham M, Finn JJ Jr. Этиология эпидемической плевродинии: исследование двух вирусов, выделенных из типичной вспышки. Дж Иммунол .1950 Сентябрь 65 (3): 337-46. [Медлайн].

  • Варин Дж. Ф., Дэвис Дж. Б., Сандерс Ф. К., Визосо А. Д.. Оксфордская эпидемия болезни Борнхольма, 1951. Br Med J . 1953 20 июня. 1 (4824): 1345-51. [Медлайн].

  • Нарула Дж., Хоу Б.А., Дек Г.В. Младший и др. Краткое сообщение: распознавание острого миокардита, маскирующегося под острый инфаркт миокарда. N Engl J Med . 1993 14 января. 328 (2): 100-4. [Медлайн].

  • Коно Р. Болезнь Аполлона 11 или острый геморрагический конъюнктивит: пандемия новой энтеровирусной инфекции глаз. Am J Epidemiol . 1975 Май. 101 (5): 383-90. [Медлайн].

  • Sklar VE, Patriarca PA, Onorato IM, et al. Клинические данные и результаты лечения вспышки острого геморрагического конъюнктивита в южной Флориде. Ам Дж. Офтальмол . 1983, январь, 95 (1): 45-54. [Медлайн].

  • Arnow PM, Hierholzer JC, Higbee J. Острый геморрагический конъюнктивит: вспышка смешанного вируса среди вьетнамских беженцев на Гуаме. Am J Epidemiol .1977. 105: 69.

  • Якобсон Л.М., Редд Дж. Т., Шнайдер Э. и др. Вспышка заболевания нижних дыхательных путей, связанного с энтеровирусом человека 68, среди детей американских индейцев. Педиатр Инфекция Дис. J . 2012 31 марта (3): 309-12. [Медлайн].

  • Marier R, Rodriguez W., Chloupek RJ, Brandt CD, Kim HW, Baltimore RS. Инфекция, вызванная вирусом Коксаки B5, и асептический менингит у новорожденных и детей. Ам Дж. Дис Детский . 1975 Март 129 (3): 321-5.[Медлайн].

  • Berlin LE, Rorabaugh ML, Heldrich F, Roberts K, Doran T, Modlin JF. Асептический менингит у детей младше 2 лет: диагностика и этиология. Дж. Заразить Дис . 1993 Октябрь 168 (4): 888-92. [Медлайн].

  • Хуанг С.К., Лю С.К., Чанг Ю.К., Чен С.Й., Ван СТ, Йе ТФ. Неврологические осложнения у детей с энтеровирусной инфекцией 71. N Engl J Med . 1999, 23 сентября. 341 (13): 936-42. [Медлайн].

  • Cherry JL, Soriano F, Jahn CL.Поиск перинатальной энтеровирусной инфекции. Ам Дж. Дис Детский . Сентябрь 1968 г. 116 (3): 245-50.

  • Лукашев А.Н., Королева Г.А., Лашкевич В.А., Михайлов М.И. [Энтеровирус 71: эпидемиология и диагностика]. Ж. Микробиол Эпидемиол Иммунобиол . 2009 май-июнь. 110-6. [Медлайн].

  • Du Z, Huang Y, Lawrence WR, Xu J, Yang Z, Lu J и др. Ведущие генотипы энтеровирусов, вызывающие заболевания рук, ног и рта в Гуанчжоу, Китай: взаимосвязь с климатом и вакцинация против EV71. Int J Environ Res Public Health . 2021 г. 2 января. 18 (1): [Medline].

  • Фаулкс А.Л., Хонарманд С., Глейзер С. и др. Энтеровирус-ассоциированный энцефалит в проекте Калифорнийского энцефалита, 1998-2005 гг. Дж. Заразить Дис . 2008 декабрь 1. 198 (11): 1685-91. [Медлайн].

  • Роден В.Дж., Кантор Х.Э., О’Коннор Д.М., Шмидт Р.Р., Черри Д.Д. Острая гемифегия в детском возрасте, связанная с вирусной инфекцией Коксаки A9. Дж. Педиатр .1975, январь, 86 (1): 56-8. [Медлайн].

  • Whitley RJ, Cobbs CG, Alford CA Jr и др. Заболевания, имитирующие герпетический энцефалит. Диагноз, представление и результат. Группа совместных антивирусных исследований НИАД. ЯМА . 1989, 14 июля. 262 (2): 234-9. [Медлайн].

  • Барак Ю., Шварц Дж. Ф. Острый поперечный миелит, связанный с инфекцией ECHO 5 типа. Ам Дж. Дис Детский . 1988 Февраль 142 (2): 128. [Медлайн].

  • Rotbart HA, Brennan PJ, Fife KH, et al.Энтеровирусный менингит у взрослых. Клин Инфекция Дис . 1998 27 октября (4): 896-8. [Медлайн].

  • Mathes EF, Oza V, Frieden IJ, et al. «Экзема коксаки» и необычные кожные проявления при вспышке энтеровируса. Педиатрия . 2013 июл.132 (1): e149-57. [Медлайн].

  • Begier EM, Oberste MS, Landry ML, et al. Вспышка одновременных инфекций echovirus 30 и coxsackievirus A1, связанных с морским плаванием, среди группы путешественников в Мексику. Клин Инфекция Дис . 2008 г., 1. 47 (5): 616-23. [Медлайн].

  • Chung WH, Shih SR, Chang CF и др. Клинико-патологический анализ вируса Коксаки A6, вызванного новым вариантом широко распространенных кожно-слизистых буллезных реакций, имитирующих тяжелые кожные побочные реакции. Дж. Заразить Дис . 30 августа 2013 г. [Medline].

  • Поццетто Б., Годин О.Г., Ауни М., Рос А. Сравнительная оценка ответа нейтрализующих иммуноглобулин М антител в сыворотках острой фазы и выделение вируса для рутинной диагностики энтеровирусной инфекции. Дж. Клин Микробиол . 1989, 27 апреля (4): 705-8. [Медлайн]. [Полный текст].

  • Trabelsi A, Grattard F, Nejmeddine M, Aouni M, Bourlet T, Pozzetto B. Оценка моноклонального антитела 5-D8 / 1 к группе энтеровирусов, специфичного к группе энтеровирусов, в сравнении с нейтрализацией и ПЦР для быстрой идентификации энтеровирусов в культуре клеток. Дж. Клин Микробиол . 1995 Сентябрь 33 (9): 2454-7. [Медлайн]. [Полный текст].

  • Rotbart HA, Sawyer MH, Fast S и др.Диагностика энтеровирусного менингита с помощью ПЦР с колориметрическим методом обнаружения микролунок. Дж. Клин Микробиол . 1994, 32 октября (10): 2590-2. [Медлайн]. [Полный текст].

  • Halonen P, Rocha E, Hierholzer J, et al. Обнаружение энтеровирусов и риновирусов в клинических образцах с помощью ПЦР и жидкофазной гибридизации. Дж. Клин Микробиол . 1995 Mar.33 (3): 648-53. [Медлайн].

  • Archimbaud C, Chambon M, Bailly JL, et al.Влияние быстрой молекулярной диагностики энтеровирусов на лечение младенцев, детей и взрослых с асептическим менингитом. J Med Virol . 2009 Январь 81 (1): 42-8. [Медлайн].

  • Xiao XL, Wu H, Li YJ, et al. Одновременное обнаружение энтеровируса 70 и варианта вируса Коксаки А24 с помощью мультиплексной ОТ-ПЦР в реальном времени с использованием внутреннего контроля. Дж. Вироловые методы . 2009 Июль 159 (1): 23-8. [Медлайн].

  • Авнер Э, Сац Дж, Плоткин С.А.Гипогликоррахия у детей раннего возраста с вирусным менингитом. Дж. Педиатр . 1975. 87: 883.

  • Гарг А., Шиау Дж., Гайятт Г. Неэффективность иммуносупрессивной терапии при лимфоцитарном миокардите: обзор. Энн Интерн Мед. 1998 15 августа. 129 (4): 317-22. [Медлайн].

  • Goland S, Czer LS, Siegel RJ, et al. Внутривенное лечение иммуноглобулином при острой фульминантной воспалительной кардиомиопатии: серия из шести пациентов и обзор литературы. Банка Кардиол . 24 июля 2008 г. (7): 571-4. [Медлайн]. [Полный текст].

  • Rotbart HA, Webster AD. Лечение потенциально опасных для жизни энтеровирусных инфекций плеконарилом. Клин Инфекция Дис . 2001 15 января. 32 (2): 228-35. [Медлайн].

  • Мейсон Дж. У., О’Коннелл Дж. Б., Херсковиц А. и др. Клиническое испытание иммуносупрессивной терапии миокардита. Исследователи по лечению миокардита. N Engl J Med .1995 г. 3 августа. 333 (5): 269-75. [Медлайн].

  • Брунетти Л., ДеСантис ER. Лечение вирусного миокардита, вызванного вирусом Коксаки B. Am J Health Syst Pharm . 2008 15 января. 65 (2): 132-7. [Медлайн].

  • Engelmann I, Dewilde A, Lazrek M, Batteux M, Hamissi A, Yakoub-Agha I, et al. Персистенция риновирусов человека у пациентов с ослабленным иммунитетом in vivo. PLoS Один . 2017 2 февраля. 12 (2): e0170774. [Медлайн].

  • Кью О., Моррис-Глазго В., Ландаверде М. и др.Вспышка полиомиелита в Hispaniola, связанная с циркулирующим полиовирусом вакцинного происхождения 1 типа. Наука . 2002, 12 апреля. 296 (5566): 356-9. [Медлайн].

  • Комбинированная иммунизация младенцев пероральной и инактивированной полиовакцинами: результаты рандомизированного исследования в Гамбии, Омане и Таиланде. Совместная исследовательская группа ВОЗ по пероральным и инактивированным полиовирусным вакцинам. Дж. Заразить Дис . 1997 г., февраль 175, Приложение 1: S215-27. [Медлайн].

  • Саттер Р.В., Джон Т.Дж., Джейн Х. и др.Иммуногенность бивалентной пероральной полиовакцины типа 1 и 3: рандомизированное двойное слепое контролируемое исследование. Ланцет . 13 ноября 2010 г. 376 (9753): 1682-8. [Медлайн].

  • Lalani S, Gew LT, Poh CL. Противовирусные пептиды против энтеровируса A71, вызывающего заболевание рук, ягодиц и рта. Пептиды . 2021, февраль, 136: 170443. [Медлайн].

  • Li J, Yin X, Lin A, Nie X, Liu L, Liu S и др. Вакцинация EV71 влияет на заболеваемость энцефалитом у пациентов с заболеваниями рук, ящура и рта. Вакцина для человека Иммунодермия . 2021 31 января. 1-4. [Медлайн].

  • Wadia NH, Katrak SM, Misra VP и др. Моторный паралич, похожий на полиомиелит, связанный с острым геморрагическим конъюнктивитом во время вспышки в 1981 г. в Бомбее, Индия: клинические и серологические исследования. Дж. Заразить Дис . 1983 г., апрель, 147 (4): 660-8. [Медлайн].

  • Майер А, МакГриви А, Бут TF. Молекулярная патогенность энтеровирусов, вызывающих неврологические заболевания. Передний микробиол .2020. 11: 540. [Медлайн].

  • Инфекция, вызванная вирусом ветряной оспы | Nature Reviews Disease Primers

  • 1

    Гилден, Д., Корс, Р. Дж., Махалингам, Р. и Нагель, М. А. Неврологическое заболевание, вызванное реактивацией вируса ветряной оспы без сыпи. Curr. Верхний. Microbiol. Иммунол. 342 , 243–253 (2010).

    CAS PubMed PubMed Central Google ученый

  • 2

    Гершон, А.А. и Гершон, М. Д. Патогенез и современные подходы к борьбе с вирусными инфекциями ветряной оспы. Clin. Microbiol. Ред. 26 , 728–743 (2013).

    CAS Статья PubMed PubMed Central Google ученый

  • 3

    Гершон, А., Такахаши, М. и Сьюард, Дж. Ф. в статье Vaccines (ред. Плоткин, С., Оренштейн, В. и Оффит, П.) 915–958 (Saunders Elsevier, 2011).

    Google ученый

  • 4

    Цолия, М., Гершон, А. А., Стейнберг, С. П. и Гелб, Л. Живая аттенуированная вакцина против ветряной оспы: доказательства того, что вирус ослаблен, и важность кожных повреждений в передаче вируса ветряной оспы. Национальный институт аллергии и инфекционных заболеваний, группа совместных исследований вакцины против ветряной оспы. J. Pediatr. 116 , 184–189 (1990). Исследование, демонстрирующее, что VZV распространяется через кожные поражения.

    CAS Статья PubMed PubMed Central Google ученый

  • 5

    Чен, Дж.J., Zhu, Z., Gershon, A. A. & Gershon, M. D. Зависимость от маннозо-6-фосфатного рецептора вируса ветряной оспы in vitro и в эпидермисе во время ветряной оспы и опоясывающего лишая. Cell 119 , 915–926 (2004). Это исследование демонстрирует важность кожи в инфекции VZV и определяет клеточный рецептор, который вирус использует для инфекции.

    CAS Статья PubMed PubMed Central Google ученый

  • 6

    Веллер Т.H. Varicella: историческая перспектива и клинический обзор. J. Infect. Дис. 174 (Дополнение), S306 – S309 (1996).

    Артикул PubMed PubMed Central Google ученый

  • 7

    Всемирная организация здравоохранения. Вакцины против ветряной оспы и опоясывающего лишая: документ с изложением позиции ВОЗ, июнь 2014 г. Wkly Epidemiol. Рек. 89 , 265–287 (2014).

    Google ученый

  • 8

    Брейер, Дж., Grose, C., Norberg, P., Tipples, G. & Schmid, DS Предложение по общей номенклатуре для вирусных клад, которые образуют вирус ветряной оспы видов: резюме совещания по номенклатуре VZV 2008, Barts и Лондонской школы Медицина и стоматология, 24–25 июля 2008 г. J. Gen. Virol. 91 , 821–828 (2010). В этом документе описываются пять различных классов VZV.

    CAS Статья PubMed PubMed Central Google ученый

  • 9

    Марин, М., Гурис, Д., Чавес, С. С., Шмид, С. и Сьюард, Дж. Ф. Профилактика ветряной оспы: рекомендации Консультативного комитета по практике иммунизации (ACIP). MMWR. Рекоменд. Отчет 56 , 1–40 (2007).

    PubMed PubMed Central Google ученый

  • 10

    Лиянаге, Н. П. М. и др. . Распространенность инфекции вирусом ветряной оспы опоясывающего лишая в округе Коломбо, Шри-Ланка. Indian J. Med. Sci. 61 , 128–134 (2007).

    CAS Статья PubMed PubMed Central Google ученый

  • 11

    Лолеха С. и др. . Влияние климатических факторов и плотности населения на эпидемиологию вируса ветряной оспы в тропической стране. Am. J. Trop. Med. Hyg. 64 , 131–136 (2001).

    CAS Статья PubMed PubMed Central Google ученый

  • 12

    Изуриета, Х.С., Штребель П. М. и Блейк П. А. Постлицензионная эффективность вакцины против ветряной оспы во время вспышки болезни в детском учреждении. JAMA 278 , 1495–1499 (1997).

    CAS Статья PubMed PubMed Central Google ученый

  • 13

    Леви, М. Х. и др. . Оспа в доках: вспышка ветряной оспы в тюремной системе Австралии. Опубл. Здравоохранение 117 , 446–451 (2003).

    Артикул Google ученый

  • 14

    Longfield, J.Н., Винн, Р. Э., Гибсон, Р. Л., Джухау, С. В. и Хоффман, П. В. Вспышки ветряной оспы у новобранцев из Пуэрто-Рико. Восприимчивость к ветряной оспе у населения из тропиков. Arch. Междунар. Med. 150 , 970–973 (1990).

    CAS Статья PubMed PubMed Central Google ученый

  • 15

    Галил, К., Браун, К., Лин, Ф. и Сьюард, Дж. Госпитализации по поводу ветряной оспы в США, 1988–1999 гг. Pediatr. Заразить. Дис. J. 21 , 931–935 (2002). В этом документе описываются эффекты вакцины против ветряной оспы (снижение заболеваемости и смертности в США).

    Артикул PubMed PubMed Central Google ученый

  • 16

    Роусон, Х., Крампин, А. и Ноа, Н. Смертность от ветряной оспы в Англии и Уэльсе, 1995-7: анализ стандартных данных о смертности. BMJ 323 , 1091–1093 (2001).

    CAS Статья PubMed PubMed Central Google ученый

  • 17

    Эндерс, G. Инфекция вируса ветряной оспы при беременности. Прог. Med. Virol. 29 , 166–196 (1984).

    CAS PubMed PubMed Central Google ученый

  • 18

    Биалек С. Р. и др. . Влияние стандартной программы вакцинации против ветряной оспы двумя дозами на эпидемиологию ветряной оспы. Педиатрия 132 , e1134 – e1140 (2013).

    Артикул PubMed PubMed Central Google ученый

  • 19

    Марин, М., Чжан, Дж. Х. и Сьюард, Дж. Ф. Практически полностью ликвидированы случаи смерти от ветряной оспы в США после реализации программы вакцинации. Педиатрия 128 , 214–220 (2011).

    Артикул PubMed PubMed Central Google ученый

  • 20

    Хоуп-Симпсон, Р.E. Природа опоясывающего лишая: долгосрочное исследование и новая гипотеза. Proc. R. Soc. Med. 58 , 9–20 (1965). Эта статья демонстрирует зависящую от возраста заболеваемость и тяжесть опоясывающего лишая и представляет гипотезу о сложном иммунном ответе на вирус.

    CAS PubMed PubMed Central Google ученый

  • 21

    Weitzman, D. и др. . Популяционное исследование эпидемиологии опоясывающего герпеса и его осложнений. J. Infect. 67 , 463–469 (2013).

    Артикул PubMed PubMed Central Google ученый

  • 22

    Oxman, M. N. и др. . Вакцина для профилактики опоясывающего герпеса и постгерпетической невралгии у пожилых людей. N. Engl. J. Med. 352 , 2271–2284 (2005). Эта статья представляет собой первую демонстрацию успешной терапевтической вакцины против опоясывающего лишая.

    CAS Статья PubMed PubMed Central Google ученый

  • 23

    Зева, Б.P. и др. . Популяционное исследование заболеваемости и частоты осложнений опоясывающего герпеса до введения вакцины против опоясывающего лишая. Mayo Clin. Proc. 82 , 1341–1349 (2007).

    Артикул PubMed PubMed Central Google ученый

  • 24

    Форбс, Х. Дж. и др. . Количественная оценка факторов риска опоясывающего герпеса: популяционное исследование случай – контроль. BMJ 348 , g2911 (2014).

    Артикул CAS PubMed PubMed Central Google ученый

  • 25

    Шмадер К., Джордж Л. К., Берчетт Б. М., Пипер К. Ф. и Гамильтон Дж. Д. Расовые различия в возникновении опоясывающего герпеса. J. Infect. Дис. 171 , 701–704 (1995).

    CAS Статья PubMed PubMed Central Google ученый

  • 26

    Арвин, А.М., Коропчак, С. М. и Виттек, А. Е. Иммунологические доказательства реинфекции вирусом ветряной оспы. J. Infect. Дис. 148 , 200–205 (1983).

    CAS Статья PubMed PubMed Central Google ученый

  • 27

    Томас, С. Л., Уиллер, Дж. Дж. И Холл, А. Дж. Контакты с ветряной оспой или детьми и защита от опоясывающего герпеса у взрослых: исследование случай – контроль. Ланцет 360 , 678–682 (2002).

    Артикул PubMed PubMed Central Google ученый

  • 28

    Brisson, M. и др. . Моделирование влияния вакцинации против ветряной оспы одной и двумя дозами на эпидемиологию ветряной оспы и опоясывающего лишая. Вакцина 28 , 3385–3397 (2010).

    CAS Статья PubMed PubMed Central Google ученый

  • 29

    Хейлз, К. М., Harpaz, R., Joesoef, M. R. & Bialek, S. R. Исследование связей между заболеваемостью опоясывающим герпесом и вакцинацией против ветряной оспы у детей. Ann. Междунар. Med. 159 , 739–745 (2013).

    Артикул PubMed PubMed Central Google ученый

  • 30

    Leung, J., Harpaz, R., Molinari, N.-A., Jumaan, A. & Zhou, F. Заболеваемость опоясывающим герпесом среди застрахованных в США, 1993-2006 гг .: оценка воздействия вакцинации против ветряной оспы. Clin. Заразить. Дис. 52 , 332–340 (2011).

    Артикул PubMed PubMed Central Google ученый

  • 31

    Харди И., Гершон А. А., Стейнберг С. П. и Ла Русса П. Заболеваемость опоясывающим лишаем после иммунизации живой аттенуированной вакциной против ветряной оспы. Исследование на детях с лейкемией. Группа совместных исследований вакцины против ветряной оспы. N. Engl. J. Med. 325 , 1545–1550 (1991). Эта статья представляет собой первое убедительное доказательство того, что вакцинация против ветряной оспы снижает заболеваемость опоясывающим лишаем.

    CAS Статья PubMed PubMed Central Google ученый

  • 32

    Ku, C.-C., Padilla, JA, Grose, C., Butcher, EC & Arvin, AM Тропизм вируса ветряной оспы для CD4 миндалин человека + Т-лимфоцитов, которые экспрессируют активацию, память, и кожные маркеры самонаведения. Дж.Virol. 76 , 11425–11433 (2002).

    CAS Статья PubMed PubMed Central Google ученый

  • 33

    Ku, C.-C. и др. . Перенос вируса ветряной оспы на кожу Т-клетками и модуляция репликации вируса интерфероном-α эпидермальных клеток. J. Exp. Med. 200 , 917–925 (2004). В этой статье показано, как VZV заражает человека-хозяина при первичной инфекции, как вирус распространяется в организме и какова роль врожденного иммунитета в борьбе с ним на раннем этапе.

    CAS Статья PubMed PubMed Central Google ученый

  • 34

    Сен, Н. и др. . Одноклеточный цитометрический анализ ремоделирования Т-клеток миндалин человека вирусом ветряной оспы. Cell Rep. 8 , 633–645 (2014). Эта статья представляет собой первую демонстрацию того, что VZV ремоделирует клетки-хозяева для увеличения их инфекционности.

    CAS Статья PubMed PubMed Central Google ученый

  • 35

    Левин, М.J. Вирус ветряной оспы и вирусная ДНК в крови и ротоглотке людей с латентными или активными инфекциями вируса ветряной оспы. J. Clin. Virol. 61 , 487–495 (2014).

    CAS Статья PubMed PubMed Central Google ученый

  • 36

    Арвин, А. М. и Гилден, Д. Х. в Fields Virology (редакторы Knipe, D. и Howley, P.) 2015–2057 (Lippincott, 2013).

    Google ученый

  • 37

    Гершон, А.А. и др. . Латентность вируса ветряной оспы в спинном корне, краниальных и кишечных ганглиях у вакцинированных детей. Пер. Являюсь. Clin. Climatol. Доц. 123 , 17–33; обсуждение 33–35 (2012).

    PubMed PubMed Central Google ученый

  • 38

    Махалингам, Р. и др. . Вирус ветряной оспы обезьян заражает ганглии до появления сыпи у экспериментально инфицированных обезьян. Вирусология 279 , 339–342 (2001).

    CAS Статья PubMed PubMed Central Google ученый

  • 39

    Ган, Л., Ван, М., Чен, Дж. Дж., Гершон, М. Д. и Гершон, А. А. Инфицированные мононуклеарные клетки периферической крови передают латентную инфекцию вируса ветряной оспы в кишечную нервную систему морских свинок. J. Neurovirol. 20 , 442–456 (2014).

    CAS Статья PubMed PubMed Central Google ученый

  • 40

    Левин, М.J., Cai, G.-Y., Manchak, M.D., Pizer, L.I. ДНК вируса ветряной оспы в клетках, выделенных из ганглиев тройничного нерва человека. J. Virol. 77 , 6979–6987 (2003).

    CAS Статья PubMed PubMed Central Google ученый

  • 41

    Гэри Л., Гилден Д. Х. и Корс Р. Дж. Эпигенетическая регуляция открытых рамок считывания вируса ветряной оспы 62 и 63 в латентно инфицированных ганглиях тройничного нерва человека. J. Virol. 80 , 4921–4926 (2006).

    CAS Статья PubMed PubMed Central Google ученый

  • 42

    Амбагала, А. П. и др. . Белок немедленного раннего развития вируса ветряной оспы-опоясывающего лишая 63 взаимодействует с человеческим белком антисиленсирующей функции 1 и изменяет его способность связывать гистоны h4.1 и h4.3. J. Virol. 83 , 200–209 (2009).

    CAS Статья PubMed PubMed Central Google ученый

  • 43

    Плоткин, С.А., Штейн, С., Снайдер, М. и Иммесоте, П. Попытки извлечь вирус ветряной оспы из ганглиев. Ann. Neurol. 2 , 249 (1977).

    CAS Статья PubMed PubMed Central Google ученый

  • 44 ​​

    Оувендейк, У. Дж. Д. и др. . Ограниченная транскрипция вируса ветряной оспы в ганглиях тройничного нерва человека, полученная вскоре после смерти. J. Virol. 86 , 10203–10206 (2012).

    CAS Статья PubMed PubMed Central Google ученый

  • 45

    Чен, Дж. Дж., Гершон, А. А., Ли, З., Коулз, Р. А. и Гершон, М. Д. Вирус ветряной оспы (VZV) инфицирует и устанавливает латентный период в кишечных нейронах. J. Neurovirol. 17 , 578–589 (2011). Это исследование демонстрирует латентный период действия VZV в кишечной нервной системе.

    CAS Статья PubMed PubMed Central Google ученый

  • 46

    Гершон, А.А., Чен, Дж. И Гершон, М. Д. Модель литических, латентных и реактивирующих вирусных инфекций ветряной оспы в изолированных кишечных нейронах. J. Infect. Дис. 197 (Дополнение), S61 – S65 (2008).

    Артикул PubMed PubMed Central Google ученый

  • 47

    Чен, Дж. Дж., Гершон, А. А., Ли, З. С., Лунгу, О. и Гершон, М. Д. Скрытая и литическая инфекция изолированных кишечных ганглиев морских свинок вирусом ветряной оспы. J. Med. Virol. 70 (Дополнение 1), S71 – S78 (2003).

    Артикул PubMed PubMed Central Google ученый

  • 48

    Хед Х., Кэмпбелл А. и Кеннеди П. Патология опоясывающего герпеса и ее влияние на сенсорную локализацию. Rev. Med. Virol. 7 , 131–143 (1997).

    CAS Статья PubMed PubMed Central Google ученый

  • 49

    Шмидбауэр, М., Будка, Х., Пилз, П., Курата, Т. и Хондо, Р. Присутствие, распространение и распространение продуктивной инфекции вируса ветряной оспы в нервных тканях. Мозг 115 , 383–398 (1992).

    Артикул PubMed PubMed Central Google ученый

  • 50

    Стейн, М. и др. . Анализ Т-клеточных ответов во время активной реактивации вируса ветряной оспы в ганглиях человека. J. Virol. 88 , 2704–2716 (2014).

    Артикул CAS PubMed PubMed Central Google ученый

  • 51

    Гоуришанкар, К. и др. . Характеристика иммунного ответа хозяина в ганглиях человека после опоясывающего герпеса. J. Virol. 84 , 8861–8870 (2010). Эта статья описывает иммунологические события в латентно инфицированных ганглиях задних корешков.

    CAS Статья PubMed PubMed Central Google ученый

  • 52

    Гринфельд, Э.И Кеннеди, П. Г. Э. Трансляция генов вируса ветряной оспы и опоясывающего лишая во время ганглиозного латентного периода человека. Гены вирусов 29 , 317–319 (2004).

    CAS Статья PubMed PubMed Central Google ученый

  • 53

    Lungu, O., Panagiotidis, C. A., Annunziato, P. W., Gershon, A. A., Silverstein, S. J. Аберрантная внутриклеточная локализация регуляторных белков вируса ветряной оспы в латентный период. Proc.Natl Acad. Sci. США 95 , 7080–7085 (1998).

    CAS Статья PubMed PubMed Central Google ученый

  • 54

    Cohrs, R.J., Gilden, D.H., Kinchington, P.R., Grinfeld, E. & Kennedy, P.G.E. Транскрипция и трансляция гена 66 вируса ветряной оспы и опоясывающего лишая в латентно инфицированных ганглиях человека. J. Virol. 77 , 6660–6665 (2003). Исследование экспрессии гена VZV при латентной инфекции нейронов.

    CAS Статья PubMed PubMed Central Google ученый

  • 55

    Азарх Ю., Гилден Д. и Корс Р. Дж. Молекулярная характеристика вируса ветряной оспы в латентно инфицированных ганглиях человека: физическое состояние и количество ДНК VZV, количественное определение вирусных транскриптов и обнаружение VZV-специфических белков. Curr. Верхний. Microbiol. Иммунол. 342 , 229–241 (2010).

    CAS PubMed PubMed Central Google ученый

  • 56

    Уолтерс, М.S., Kyratsous, C.A., Wan, S. & Silverstein, S. Ядерный импорт белка ORF63, связанного с латентностью вируса ветряной оспы и опоясывающего лишая, в первичных нейронах требует экспрессии литического белка ORF61 и происходит протеасомозависимым образом. J. Virol. 82 , 8673–8686 (2008).

    CAS Статья PubMed PubMed Central Google ученый

  • 57

    Zerboni, L. и др. . Экспрессия немедленного раннего регуляторного белка IE63 вируса ветряной оспы в нейронах латентно инфицированных сенсорных ганглиев человека. J. Virol. 84 , 3421–3430 (2010).

    CAS Статья PubMed PubMed Central Google ученый

  • 58

    Zerboni, L. и др. . Видимая экспрессия белков вируса ветряной оспы в латентный период является результатом реактивности антител мыши и кролика с детерминантами группы крови человека в сенсорных нейронах. J. Virol. 86 , 578–583 (2012).

    CAS Статья PubMed PubMed Central Google ученый

  • 59

    Stowasser, M., Кэмерон, Дж. И Оливер, У. А. Диафрагмальный паралич после опоясывающего герпеса шейки матки. Med. J. Aust. 153 , 555–556 (1990).

    CAS PubMed PubMed Central Google ученый

  • 60

    Еллинек, Э. Х. и Туллох, У. С. Опоясывающий лишай с дисфункцией мочевого пузыря и заднего прохода. Lancet 2 , 1219–1222 (1976).

    CAS Статья PubMed PubMed Central Google ученый

  • 61

    Умехара, Т., Сэнгоку, Р., Мицумура, Х. и Мочио, С. Неврологическая картина. Обнаружение пареза сегментарного опоясывающего лишая на МРТ. J. Neurol. Нейрохирургия. Психиатрия 82 , 694 (2011).

    Артикул PubMed PubMed Central Google ученый

  • 62

    Choi, J.-Y., Kang, C.H., Kim, B.-J., Park, K.-W. И Ю, С.-В. Плечевая плексопатия после инфекции опоясывающего герпеса: два случая с результатами МРТ. J. Neurol. Sci. 285 , 224–226 (2009).

    Артикул PubMed PubMed Central Google ученый

  • 63

    Томас, Дж. Э. и Ховард, Ф. М. Сегментарный парез опоясывающего лишая — профиль заболевания. Неврология 22 , 459–466 (1972).

    CAS Статья PubMed PubMed Central Google ученый

  • 64

    Смит, Ф. П. Патологические исследования ганглиев спинномозговых нервов в связи с трудноизлечимой межреберной болью. Surg. Neurol. 10 , 50–53 (1978).

    CAS PubMed PubMed Central Google ученый

  • 65

    Уотсон, К. П., Ватт, В. Р., Чипман, М., Биркетт, Н. и Эванс, Р. Дж. Прогноз при постгерпетической невралгии. Боль 46 , 195–199 (1991).

    CAS Статья PubMed PubMed Central Google ученый

  • 66

    Лай, Дж., Porreca, F., Hunter, J.C. & Gold, M.S., натриевые каналы, управляемые напряжением, и гипералгезия. Annu. Rev. Pharmacol. Toxicol. 44 , 371–397 (2004).

    CAS Статья PubMed PubMed Central Google ученый

  • 67

    Кеннеди, П. Г. Э. и др. . Вирусы ветряной оспы, связанные с постгерпетической невралгией, вызывают увеличение плотности тока натрия в клеточной линии нейробластомы ND7-23 Nav-1.8. PLoS ONE 8 , e51570 (2013).

    CAS Статья PubMed PubMed Central Google ученый

  • 68

    Махалингам, Р., Веллиш, М., Бруклиер, Дж. И Гилден, Д. Х. Сохранение ДНК вируса ветряной оспы у пожилых пациентов с постгерпетической невралгией. J. Neurovirol. 1 , 130–133 (1995).

    CAS Статья PubMed PubMed Central Google ученый

  • 69

    Гилден, Д.Х., Корс, Р. Дж., Хейворд, А. Р., Веллиш, М. и Махалингам, Р. Хронический ганглионит, вызванный вирусом ветряной оспы и опоясывающего лишая — возможная причина постгерпетической невралгии. J. Neurovirol. 9 , 404–407 (2003).

    CAS Статья PubMed PubMed Central Google ученый

  • 70

    Beutner, K. R., Friedman, D. J., Forszpaniak, C., Andersen, P. L. & Wood, M. J. Валацикловир по сравнению с ацикловиром для улучшенной терапии опоясывающего герпеса у иммунокомпетентных взрослых. Антимикробный. Агенты Chemother. 39 , 1546–1553 (1995).

    CAS Статья PubMed PubMed Central Google ученый

  • 71

    Degreef, H. Фамцикловир, новый пероральный антигерпесный препарат: результаты первого контролируемого клинического исследования, демонстрирующие его эффективность и безопасность при лечении неосложненного опоясывающего герпеса у иммунокомпетентных пациентов. Внутр. J. Antimicrob. Агенты 4 , 241–246 (1994).

    CAS Статья PubMed PubMed Central Google ученый

  • 72

    Акоста, Э. П. и Бальфур, Х. Х. Ацикловир для лечения постгерпетической невралгии: эффективность и фармакокинетика. Антимикробный. Агенты Chemother. 45 , 2771–2774 (2001).

    CAS Статья PubMed PubMed Central Google ученый

  • 73

    Куан, Д., Hammack, B. N., Kittelson, J. & Gilden, D. H. Улучшение постгерпетической невралгии после лечения внутривенным ацикловиром с последующим пероральным валацикловиром. Arch. Neurol. 63 , 940–942 (2006).

    Артикул PubMed PubMed Central Google ученый

  • 74

    Чен, Н. и др. . Противовирусное лечение для профилактики постгерпетической невралгии. Кокрановская база данных Syst. Ред. 2 , CD006866 (2014).

    Google ученый

  • 75

    Соломон, К. Г., Джонсон, Р. В. и Райс, А. С. Постгерпетическая невралгия. N. Engl. J. Med. 371 , 1526–1533 (2014).

    Артикул CAS Google ученый

  • 76

    Кляйн, Н.С., Макдермотт, Б. и Кунха, Б.А. Менингоэнцефалит, вызванный вирусом ветряной оспы, у иммунокомпетентного пациента без сыпи. Сканд.J. Infect. Дис. 42 , 631–633 (2010).

    Артикул PubMed PubMed Central Google ученый

  • 77

    Гансон, Р. Н., Эйткен, К. и Гилден, Д. Женщина с острой головной болью и онемением дерматомов крестца. J. Clin. Virol. 50 , 191–193 (2011).

    CAS Статья PubMed PubMed Central Google ученый

  • 78

    Рацка, П., Schlachetzki, J. C. M., Bähr, M. & Nau, R. Церебеллит, вызванный вирусом Varicella zoster, у 66-летнего пациента без опоясывающего герпеса. Ланцет 367 , 182 (2006).

    Артикул PubMed PubMed Central Google ученый

  • 79

    Чикконе, С. и др. . Инсульт после инфекции ветряной оспы: отчет о случае и обзор литературы. Pediatr. Заразить. Дис. J. 29 , 864–867 (2010).

    Артикул PubMed PubMed Central Google ученый

  • 80

    Kang, J.-H., Ho, J.-D., Chen, Y.-H. И Лин, Х.-К. Повышенный риск инсульта после приступа опоясывающего герпеса: последующее популяционное исследование. Инсульт. 40 , 3443–3448 (2009).

    CAS Статья PubMed PubMed Central Google ученый

  • 81

    Нагель, М.А. и др. . Васкулопатии, вызванные вирусом ветряной оспы: клинические, спинномозговые, визуализация и вирусологические особенности. Неврология 70 , 853–860 (2008). Эта статья демонстрирует, что васкулопатии VZV в церебральных артериях приводят к инсультам.

    CAS Статья PubMed PubMed Central Google ученый

  • 82

    Lin, H.-C., Chien, C.-W. И Хо, Ж.-Д. Офтальмологический опоясывающий герпес и риск инсульта: последующее популяционное исследование. Неврология 74 , 792–797 (2010).

    Артикул PubMed PubMed Central Google ученый

  • 83

    Hilt, D. C., Buchholz, D., Krumholz, A., Weiss, H. & Wolinsky, J. S. Herpes zoster ophthalmicus и отсроченный контралатеральный гемипарез, вызванный церебральным ангиитом: подходы к диагностике и лечению. Ann. Neurol. 14 , 543–553 (1983).

    CAS Статья PubMed PubMed Central Google ученый

  • 84

    Бурдетт, Д.Н., Розенберг, Н. Л. и Яцу, Ф. М. Офтальмологический опоясывающий лишай и отсроченный ипсилатеральный инфаркт головного мозга. Неврология 33 , 1428–1432 (1983). В этом документе показана связь между инфекцией VZV и инсультом.

    CAS Статья PubMed PubMed Central Google ученый

  • 85

    Нагель М.А. и др. . Васкулопатия вируса ветряной оспы: анализ артерий, инфицированных вирусом. Неврология 77 , 364–370 (2011).

    CAS Статья PubMed PubMed Central Google ученый

  • 86

    Gilden, D., Cohrs, R.J., Mahalingam, R. & Nagel, M.A. Васкулопатии, вызванные вирусом Varicella zoster: различные клинические проявления, лабораторные особенности, патогенез и лечение. Lancet Neurol. 8 , 731–740 (2009).

    Артикул PubMed PubMed Central Google ученый

  • 87

    Grose, C.Инсульт после ветряной оспы и опоясывающего лишая: еще одно показание для лечения и иммунизации. Pediatr. Заразить. Дис. J. 29 , 868–869 (2010).

    Артикул PubMed PubMed Central Google ученый

  • 88

    Гилден Д. и др. . Распространенность и распространение VZV в височных артериях у пациентов с гигантоклеточным артериитом. Неврология 84 , 1948–1955 (2015).

    Артикул PubMed PubMed Central Google ученый

  • 89

    Franco-Paredes, C. и др. . Асептический менингит и неврит зрительного нерва, предшествующие прогрессирующему наружному некрозу сетчатки при ветряной оспе и опоясывающем лице у пациента со СПИДом. AIDS 16 , 1045–1049 (2002).

    Артикул PubMed PubMed Central Google ученый

  • 90

    Фурута, Ю. и др. . Реактивация вируса ветряной оспы — важная причина острого периферического паралича лицевого нерва у детей. Pediatr. Заразить.Дис. J. 24 , 97–101 (2005).

    Артикул PubMed PubMed Central Google ученый

  • 91

    Пахуд, Б.А., Глейзер, К.А., Деккер, К.Л., Арвин, А.М. и Шмид, Д.С. Ветряная оспа, заболевание центральной нервной системы: эпидемиологические, клинические и лабораторные особенности через 10 лет после введения вакцины против ветряной оспы. J. Infect. Дис. 203 , 316–323 (2011). В этой статье описываются менингит и энцефалит, вызванные VZV, часто без сыпи.

    Артикул PubMed PubMed Central Google ученый

  • 92

    Гилден Д. Х., Дуэланд А. Н., Девлин М. Э., Махалингам Р. и Корс Р. Реактивация вируса ветряной оспы без сыпи. J. Infect. Дис. 166 (Дополнение), S30 – S34 (1992).

    Артикул PubMed PubMed Central Google ученый

  • 93

    Гилден, Д.Х. и др. . Вирус ветряной оспы, причина прогрессирующего и убывающего васкулита: повторный визит в Медицинский журнал Новой Англии, случай 5–1995. Неврология 47 , 1441–1446 (1996).

    CAS Статья PubMed PubMed Central Google ученый

  • 94

    Кляйншмидт-ДеМастерс, Б. К. и Гилден, Д. Х. Инфекции нервной системы, вызванные вирусом ветряной оспы и опоясывающего лишая: клинические и патологические корреляты. Arch. Патол. Лаборатория. Med. 125 , 770–780 (2001).

    CAS PubMed PubMed Central Google ученый

  • 95

    МакКелви, П. А. и др. . Менингоэнцефаломиелит с васкулитом, вызванным вирусом ветряной оспы: описание случая и обзор литературы. Патология 34 , 88–93 (2002).

    Артикул PubMed PubMed Central Google ученый

  • 96

    Langan, S.М., Минасян, К., Смит, Л. и Томас, С. Л. Риск инсульта после опоясывающего герпеса: самоуправляемое исследование серии случаев. Clin. Заразить. Дис. 58 , 1497–1503 (2014).

    Артикул PubMed PubMed Central Google ученый

  • 97

    Брейер, Дж., Пакоу, М., Готье, А. и Браун, М. М. Опоясывающий лишай как фактор риска инсульта и ТИА: ретроспективное когортное исследование в Великобритании. Неврология 82 , 206–212 (2014). Эта статья обеспечивает дальнейшее признание взаимосвязи между VZV и инсультом.

    CAS Статья PubMed PubMed Central Google ученый

  • 98

    Гилден Д. Х. и др. . Миелит, вызванный вирусом ветряной оспы и опоясывающего лишая: расширяющийся спектр. Неврология 44 , 1818–1823 (1994).

    CAS Статья PubMed PubMed Central Google ученый

  • 99

    Чен, Дж.J. и др. . Скрытый, литический и реактивирующий вирус ветряной оспы в ENS человека и морских свинок: может ли опоясывающий лишай кишечника быть скрытой причиной желудочно-кишечных заболеваний? Нейроастроэнтерол. Мотил. 15 , abstr. 196–237 (2003).

    Google ученый

  • 100

    Эдельман Д. А. и др. . Синдром Огилви и опоясывающий герпес: клинический случай и обзор литературы. J. Emerg. Med. 39 , 696–700 (2010).

    Артикул PubMed PubMed Central Google ученый

  • 101

    Scholl, S., Hocke, M., Hoffken, K. & Sayer, H. G. Острый живот, вызванный вирусом ветряной оспы, вызванный вирусом опоясывающего лишая после трансплантации аутологичных стволовых клеток периферической крови пациенту с неходжкинской лимфомой. Acta Haematol. 116 , 58–61 (2006).

    CAS Статья PubMed PubMed Central Google ученый

  • 102

    Гершон, А.А., Чен, Дж. И Гершон, М. Д. Использование слюны для выявления инфекции кишечника вирусом ветряной оспы (VZV). Clin. Заразить. Дис. http://dx.doi.org/10.1093/cid/civ320 (2015). Эта статья определяет инфекцию желудочно-кишечного тракта VZV при отсутствии сыпи.

  • 103

    Леунг Дж. и др. . Оценка лабораторных методов диагностики ветряной оспы. Clin. Заразить. Дис. 51 , 23–32 (2010).

    CAS Статья PubMed PubMed Central Google ученый

  • 104

    Харбек, Р. и др. . Анализ ПЦР в реальном времени для идентификации и различения дикого типа и вакцинных штаммов вируса ветряной оспы и вируса простого герпеса в клинических образцах и сравнения с клиническими диагнозами. J. Med. Virol. 81 , 1310–1322 (2009).

    CAS Статья PubMed PubMed Central Google ученый

  • 105

    Мехта, С. К. и др. . Быстрое и чувствительное обнаружение вируса ветряной оспы в слюне пациентов с опоясывающим герпесом. J. Virol. Методы 193 , 128–130 (2013). В этой статье описывается диагностика инфекции VZV путем анализа ДНК VZV в слюне.

    CAS Статья PubMed PubMed Central Google ученый

  • 106

    Мехта, С. К. и др. . Вирус ветряной оспы в слюне больных опоясывающим герпесом. J. Infect. Дис. 197 , 654–657 (2008).

    Артикул PubMed PubMed Central Google ученый

  • 107

    Фурута, Ю., Ohtani, F., Sawa, H., Fukuda, S. & Inuyama, Y. Количественное определение ДНК вируса ветряной оспы у пациентов с синдромом Рамзи Ханта и zoster sine herpete. J. Clin. Microbiol. 39 , 2856–2859 (2001).

    CAS Статья PubMed PubMed Central Google ученый

  • 108

    Puchhammer-Stöckl, E., Popow-Kraupp, T., Heinz, FX, Mandl, CW & Kunz, C. Обнаружение ДНК вируса ветряной оспы путем полимеразной цепной реакции в спинномозговой жидкости пациентов, страдающих от неврологические осложнения, связанные с ветряной оспой или опоясывающим герпесом. J. Clin. Microbiol. 29 , 1513–1516 (1991).

    PubMed PubMed Central Google ученый

  • 109

    Яэскеляйнен, А. Дж., Пийпаринен, Х., Лаппалайнен, М. и Вахери, А. Улучшенная мультиплексная ПЦР и микроматрица для обнаружения вируса герпеса из спинномозговой жидкости. J. Clin. Virol. 42 , 172–175 (2008).

    Артикул CAS PubMed PubMed Central Google ученый

  • 110

    Васкес, М. и др. . Эффективность вакцины против ветряной оспы в клинической практике. N. Engl. J. Med. 344 , 955–960 (2001).

    Артикул PubMed PubMed Central Google ученый

  • 111

    Sauerbrei, A., Taut, J., Zell, R. & Wutzler, P. Тестирование устойчивости клинических штаммов вируса ветряной оспы. Antiviral Res. 90 , 242–247 (2011).

    CAS Статья PubMed PubMed Central Google ученый

  • 112

    Куинливан, М.Л., Дженсен, Н. Дж., Рэдфорд, К. В. и Шмид, Д. С. Новые генетические вариации, выявленные в фиксированных локусах в ORF62 вакцины против ветряной оспы Окской оспы и в случае вакцино-ассоциированного опоясывающего лишая. J. Clin. Microbiol. 50 , 1533–1538 (2012). В этой статье описывается молекулярная дифференциация вируса VZV дикого типа и вакцинного типа с использованием вирусной ДНК пациентов.

    CAS Статья PubMed PubMed Central Google ученый

  • 113

    ЛаРусса, П. и др. . Полиморфизм длин рестрикционных фрагментов продуктов полимеразной цепной реакции из вакцин и изолятов вируса ветряной оспы дикого типа. J. Virol. 66 , 1016–1020 (1992).

    CAS PubMed PubMed Central Google ученый

  • 114

    Ибрахим, М. и др. . Смертельный энцефалит, вызванный вирусом ветряной оспы и опоясывающего лишая дикого типа, без сыпи у вакцинированного ребенка. Pediatr. Заразить.Дис. J. 32 , 183–185 (2013).

    Артикул PubMed PubMed Central Google ученый

  • 115

    Национальная служба здравоохранения. Справочная лаборатория по вирусу ветряной оспы. Детская больница на Грейт-Ормонд-Стрит Доверие NHS [онлайн] (2011 г.).

  • 116

    Мета, С. К. и др. . Стресс-индуцированная субклиническая реактивация вируса ветряной оспы у космонавтов. J. Med. Virol. 72 , 174–179 (2004). Это исследование описывает бессимптомную реактивацию VZV, о чем свидетельствует временное присутствие ДНК VZV в слюне.

    Артикул PubMed PubMed Central Google ученый

  • 117

    Папаевангелу В. и др. . Субклиническая реактивация VZV у иммунокомпетентных детей, госпитализированных в отделения интенсивной терапии, связана с длительной продолжительностью лихорадки. Clin. Microbiol.Заразить. 19 , E245 – E251 (2013).

    CAS Статья PubMed PubMed Central Google ученый

  • 118

    Бирлея М. и др. . Поиск ДНК вируса ветряной оспы в слюне здоровых людей в возрасте 20–59 лет. J. Med. Virol. 86 , 360–362 (2014).

    Артикул PubMed PubMed Central Google ученый

  • 119

    Такахаши, М., Otsuka, T., Okuno, Y., Asano, Y. & Yazaki, T. Живая вакцина, используемая для предотвращения распространения ветряной оспы у детей в больнице. Ланцет 2 , 1288–1290 (1974). Это исследование описывает успешное ослабление VZV и использование этого живого аттенуированного вируса для предотвращения ветряной оспы, тем самым демонстрируя первую успешную вакцину против ветряной оспы.

    CAS Статья PubMed PubMed Central Google ученый

  • 120

    Гоми, Ю. и др. . Сравнение полных последовательностей ДНК вакцины против ветряной оспы Окской и ее родительского вируса. J. Virol. 76 , 11447–11459 (2002).

    CAS Статья PubMed PubMed Central Google ученый

  • 121

    Оксман, М. Н. Зостер вакцина: текущее состояние и перспективы на будущее. Clin. Заразить. Дис. 51 , 197–213 (2010).

    Артикул PubMed PubMed Central Google ученый

  • 122

    Яманиши, К.Молекулярный анализ вакцинного штамма вируса ветряной оспы «Ока». J. Infect. Дис. 197 (Дополнение), S45 – S48 (2008). Это исследование определяет молекулярные особенности аттенуированного вакцинного штамма VZV по сравнению со штаммом дикого типа.

    CAS Статья PubMed PubMed Central Google ученый

  • 123

    Петерс, Г. А. и др. . Аттенуированный генотип вируса ветряной оспы включает мутацию переходного стоп-кодона ORF0. J. Virol. 86 , 10695–10703 (2012).

    CAS Статья PubMed PubMed Central Google ученый

  • 124

    Асано, Ю., Накаяма, Х., Язаки, Т., Като, Р. и Хиросе, С. Защита от ветряной оспы у семейных контактов путем немедленной вакцинации живой вакциной против ветряной оспы. Педиатрия 59 , 3–7 (1977). Это первая демонстрация клинической эффективности штамма «Ока» в профилактике ветряной оспы вместе с иммунологическими данными.

    CAS PubMed PubMed Central Google ученый

  • 125

    Асано Ю. и Такахаши М. Клинические и серологические испытания живой вакцины против ветряной оспы и двухлетнее наблюдение за иммунитетом вакцинированных детей. Педиатрия 60 , 810–814 (1977).

    CAS PubMed PubMed Central Google ученый

  • 126

    Гершон, А.А. и др. . Живая аттенуированная вакцина против ветряной оспы. Эффективность для детей с лейкемией в стадии ремиссии. JAMA 252 , 355–362 (1984). Эта статья представляет собой первое доказательство того, что вакцина против ветряной оспы безопасна и эффективна для профилактики ветряной оспы у детей с основным лейкозом.

    CAS Статья PubMed PubMed Central Google ученый

  • 127

    Уайт, К. Дж. Клинические испытания вакцины против ветряной оспы у здоровых детей. Заражение. Дис. Clin. North Am. 10 , 595–608 (1996).

    CAS Статья PubMed PubMed Central Google ученый

  • 128

    Уайт, К. Дж. и др. . Вакцина против ветряной оспы (VARIVAX) у здоровых детей и подростков: результаты клинических испытаний, 1987–1989 гг. Педиатрия 87 , 604–610 (1991).

    CAS PubMed PubMed Central Google ученый

  • 129

    Вейбель, Р.Е. и др. . Живая аттенуированная вакцина против вируса ветряной оспы. Испытание эффективности у здоровых детей. N. Engl. J. Med. 310 , 1409–1415 (1984). Это исследование демонстрирует, что вакцинация против ветряной оспы защищает здоровых детей от ветряной оспы.

    CAS Статья PubMed PubMed Central Google ученый

  • 130

    Шапиро, Э. Д. и др. . Эффективность 2 доз вакцины против ветряной оспы у детей. J. Infect. Дис. 203 , 312–315 (2011).

    CAS Статья PubMed PubMed Central Google ученый

  • 131

    Центры по контролю и профилактике заболеваний (CDC). Одобрение FDA на продленный период применения VariZIG для постконтактной профилактики ветряной оспы. MMWR Morb. Смертный. Wkly Rep. 61 , 212 (2012).

    Google ученый

  • 132

    Линь Т.Y., Huang, Y. C., Ning, H. C. & Hsueh, C. Пероральная профилактика ветряной оспы ацикловиром после интимного контакта. Pediatr. Заразить. Дис. J. 16 , 1162–1165 (1997).

    CAS Статья PubMed PubMed Central Google ученый

  • 133

    Хуанг, Ю. К., Лин, Т. Ю. и Чиу, К. Х. Профилактика ветряной оспы ацикловиром после заражения в домашних условиях. Pediatr. Заразить. Дис. J. 14 , 152–154 (1995).

    CAS Статья PubMed PubMed Central Google ученый

  • 134

    Klein, A., Miller, KB, Sprague, K., DesJardin, JA & Snydman, DR Рандомизированное двойное слепое плацебо-контролируемое исследование профилактики валацикловиром для предотвращения рецидива опоясывающего лишая с 4 по 24 месяцев после BMT. Пересадка костного мозга. 46 , 294–299 (2011).

    CAS Статья PubMed PubMed Central Google ученый

  • 135

    Юнгман, П. и др. . Долгосрочная профилактика ацикловиром у реципиентов трансплантата костного мозга и ответы пролиферации лимфоцитов на антигены вируса герпеса in vitro . Пересадка костного мозга. 1 , 185–192 (1986).

    CAS PubMed PubMed Central Google ученый

  • 136

    Линнеманн, К. К., Бирон, К. К., Хоппенджанс, В. Г. и Солинджер, А. М. Появление ацикловир-резистентного вируса ветряной оспы у пациента со СПИДом на длительной терапии ацикловиром. AIDS 4 , 577–579 (1990).

    Артикул PubMed PubMed Central Google ученый

  • 137

    Левин М. Дж. и др. . Развитие устойчивости к ацикловиру при хронической инфекции вакцинным штаммом «Ока» вируса ветряной оспы у ребенка с ослабленным иммунитетом. J. Infect. Дис. 188 , 954–959 (2003). Эта статья демонстрирует, что VZV может реактивироваться у детей с ослабленным иммунитетом и что вирус вакцины может стать устойчивым к ацикловиру.

    Артикул PubMed PubMed Central Google ученый

  • 138

    Bhalla, P. et al. . Распространенная, стойкая и смертельная инфекция из-за вакцинного штамма вируса ветряной оспы у взрослого после трансплантации стволовых клеток. Clin. Заразить. Дис. 60 , 1068–1074 (2015).

    CAS Статья PubMed PubMed Central Google ученый

  • 139

    Бакстер, Р. и др. . Долгосрочная эффективность вакцины против ветряной оспы: 14-летнее проспективное когортное исследование. Педиатрия 131 , e1389 – e1396 (2013).

    Артикул PubMed PubMed Central Google ученый

  • 140

    Васкес, М. и др. . Эффективность вакцины против ветряной оспы с течением времени. JAMA 291 , 851–855 (2004). Это исследование показывает, что иммунитет к ветряной оспе после вакцинации со временем существенно не ослабевает.

    Артикул PubMed PubMed Central Google ученый

  • 141

    Сьюард, Дж. Ф. и др. . Болезнь ветряной оспы после внедрения вакцины против ветряной оспы в США, 1995–2000 гг. JAMA 287 , 606–611 (2002). Это исследование демонстрирует личный и коллективный иммунитет здоровых детей в результате вакцинации.

    Артикул PubMed PubMed Central Google ученый

  • 142

    Гершон, А.А. и др. . Защитный эффект иммунологической стимуляции против опоясывающего лишая: анализ у детей с лейкемией, вакцинированных против ветряной оспы. J. Infect. Дис. 173 , 450–453 (1996).

    CAS Статья PubMed PubMed Central Google ученый

  • 143

    Бриссон, М., Эдмундс, У. Дж. И Гей, Н. Дж. Вакцинация против ветряной оспы: влияние эффективности вакцины на эпидемиологию VZV. Дж.Med. Virol. 70 (Дополнение 1), S31 – S37 (2003).

    Артикул PubMed PubMed Central Google ученый

  • 144

    Бриссон, М., Гей, Н. Дж., Эдмундс, У. Дж. И Эндрюс, Н. Дж. Воздействие ветряной оспы повышает иммунитет к опоясывающему герпесу: последствия для массовой вакцинации против ветряной оспы. Вакцина 20 , 2500–2507 (2002).

    CAS Статья PubMed PubMed Central Google ученый

  • 145

    Рейнольдс, М.А., Чавес, С. С., Харпаз, Р., Лопес, А. С. и Сьюард, Дж. Ф. Влияние программы вакцинации против ветряной оспы на эпидемиологию опоясывающего герпеса в США: обзор. J. Infect. Дис. 197 (Дополнение), S224 – S227 (2008).

    Артикул PubMed PubMed Central Google ученый

  • 146

    Гайлат, Дж. и др. . Предрасполагает ли монашеская жизнь к опасности пожара Святого Антония (опоясывающий лишай)? Clin.Заразить. Дис. 53 , 405–410 (2011). В этой статье показано, что иммунитет к VZV не требует постоянного экзогенного воздействия на VZV и что бессимптомные эпизоды реактивации VZV, вероятно, играют роль в поддержании долгосрочного иммунитета к вирусу.

    Артикул PubMed PubMed Central Google ученый

  • 147

    Сьюард, Дж. Ф., Чжан, Дж. Х., Мопин, Т. Дж., Маскола, Л. и Джумаан, А.О. Контагиозность ветряной оспы в вакцинированных случаях: исследование домашних контактов. JAMA 292 , 704–708 (2004).

    CAS Статья PubMed PubMed Central Google ученый

  • 148

    Weinmann, S. и др. . Заболеваемость и клинические характеристики опоясывающего герпеса среди детей в эпоху вакцинации против ветряной оспы, 2005–2009 гг. J. Infect. Дис. 208 , 1859–1868 (2013).

    Артикул PubMed PubMed Central Google ученый

  • 149

    Галеа, С.А. и др. . Профиль безопасности вакцины против ветряной оспы: 10-летний обзор. J. Infect. Дис. 197 (Дополнение), S165 – S169 (2008).

    Артикул PubMed PubMed Central Google ученый

  • 150

    Оксман, М. Н. Иммунизация для снижения частоты и тяжести опоясывающего герпеса и его осложнений. Неврология 45 , S41 – S46 (1995).

    CAS Статья PubMed PubMed Central Google ученый

  • 151

    Левин, М.J. in Vaccines . (ред. Плоткин, С., Оренштейн, В. и Оффит, П.) 969–980 (Elsevier, 2013).

    Книга Google ученый

  • 152

    Оксман М. Н. и Левин М. Дж. Вакцинация против опоясывающего герпеса и постгерпетической невралгии. J. Infect. Дис. 197 (Дополнение), S228 – S236 (2008).

    Артикул PubMed PubMed Central Google ученый

  • 153

    Шмадер К.Е. и др. . Влияние вакцины против опоясывающего лишая на связанное с опоясывающим герпесом вмешательство в функциональный статус и связанные со здоровьем показатели качества жизни у пожилых людей. J. Am. Гериатр. Soc. 58 , 1634–1641 (2010).

    Артикул PubMed PubMed Central Google ученый

  • 154

    Simberkoff, M. S. и др. . Безопасность вакцины против опоясывающего лишая в исследовании профилактики опоясывающего лишая: рандомизированное исследование. Ann. Междунар. Med. 152 , 545–554 (2010).

    Артикул PubMed PubMed Central Google ученый

  • 155

    Харпаз Р., Ортега-Санчес И. Р. и Сьюард Дж. Ф. Профилактика опоясывающего герпеса: рекомендации Консультативного комитета по практике иммунизации (ACIP). MMWR. Рекоменд. Rep. 57 , 1–30; викторина CE2 – CE4 (2008 г.).

    PubMed PubMed Central Google ученый

  • 156

    Ценг, Х.F. и др. . Вакцина против опоясывающего герпеса у пожилых людей и риск последующего заболевания опоясывающим герпесом. JAMA 305 , 160–166 (2011).

    CAS Статья PubMed PubMed Central Google ученый

  • 157

    Ланган, С. М., Смит, Л., Марголис, Д. Дж. И Томас, С. Л. Эффективность вакцины против опоясывающего лишая против опоясывающего герпеса и постгерпетической невралгии у пожилого населения США: когортное исследование. PLoS Med. 10 , e1001420 (2013).

    Артикул PubMed PubMed Central Google ученый

  • 158

    Schmader, K. E. et al. . Эффективность, безопасность и переносимость вакцины против опоясывающего герпеса у лиц в возрасте 50–59 лет. Clin. Заразить. Дис. 54 , 922–928 (2012).

    Артикул PubMed PubMed Central Google ученый

  • 159

    Шмадер К.Е. и др. . Устойчивость эффективности вакцины против опоясывающего лишая в исследовании профилактики опоясывающего лишая и краткосрочном исследовании устойчивости. Clin. Заразить. Дис. 55 , 1320–1328 (2012).

    CAS Статья PubMed PubMed Central Google ученый

  • 160

    Моррисон В.А. и др. . Длительное сохранение эффективности вакцины против опоясывающего лишая. Clin. Заразить. Дис. 60 , 900–909 (2014).

    Артикул PubMed PubMed Central Google ученый

  • 161

    Берковиц, Э. М. и др. . Безопасность и иммуногенность адъювантной вакцины-кандидата субъединицы опоясывающего лишая у ВИЧ-инфицированных взрослых: рандомизированное плацебо-контролируемое исследование фазы 1/2. J. Infect. Дис. 211 , 1279–1287 (2015).

    CAS Статья PubMed PubMed Central Google ученый

  • 162

    Члибек, Р. и др. . Безопасность и иммуногенность вакцины-кандидата субъединицы вируса ветряной оспы и опоясывающего лишая с адъювантом AS01 против опоясывающего герпеса у взрослых в возрасте ≥50 лет. J. Infect. Дис. 208 , 1953–1961 (2013).

    CAS Статья PubMed PubMed Central Google ученый

  • 163

    Лал, Х. и др. . Эффективность адъювантной субъединичной вакцины против опоясывающего герпеса у пожилых людей. N. Engl.J. Med. 372 , 2087–2096 (2015). Это первая демонстрация неинфекционной субъединичной вакцины с адъювантом, которая может предотвратить опоясывающий лишай у пожилых людей.

    Артикул PubMed PubMed Central Google ученый

  • 164

    Коэн, Дж. И. А. Новая вакцина для предотвращения опоясывающего герпеса. N. Engl. J. Med. 372 , 2149–2150 (2015).

    Артикул PubMed PubMed Central Google ученый

  • 165

    Классен Т.П., Хартлинг, Л., Вибе, Н. и Белсек, Э. М. Ацикловир для лечения ветряной оспы у здоровых детей и подростков. Кокрановская база данных Syst. Ред. http://dx.doi.org/10.1002/14651858.CD002980.pub3 (2005).

  • 166

    Страховка, Э. Д. и др. . Синдром Рея в США с 1981 по 1997 год. N. Engl. J. Med. 340 , 1377–1382 (1999).

    CAS Статья PubMed PubMed Central Google ученый

  • 167

    Суйри, К., Olivier, P., Grolleau, S. & Lapeyre-Mestre, M. Тяжелые некротические инфекции мягких тканей и нестероидные противовоспалительные препараты. Clin. Exp. Дерматол. 33 , 249–255 (2008).

    CAS Статья PubMed PubMed Central Google ученый

  • 168

    Комитет по инфекционным заболеваниям Американской академии педиатрии. Применение ацикловира внутрь у здоровых детей с ветряной оспой. Педиатрия 91 , 674–676 (1993).

    Google ученый

  • 169

    Фельдман, С. и Лотт, Л. Ветряная оспа у детей с онкологическими заболеваниями: влияние противовирусной терапии и профилактики. Педиатрия 80 , 465–472 (1987).

    CAS PubMed PubMed Central Google ученый

  • 170

    Etzioni, A. и др. . Смертельная ветряная оспа, связанная с селективным дефицитом естественных клеток-киллеров. J. Pediatr. 146 , 423–425 (2005). Это исследование показывает важность врожденного иммунитета в защите хозяина от VZV.

    Артикул PubMed PubMed Central Google ученый

  • 171

    Центры по контролю и профилактике заболеваний (CDC). Обновленные рекомендации по использованию VariZIG — США, 2013 г. MMWR . Morb. Смертный. Wkly Rep. 62 , 574–576 (2013).

    Google ученый

  • 172

    Пробер, К. Г., Кирк, Л. Э. и Кини, Р. Е. Терапия ветряной оспы у детей с ослабленным иммунитетом ацикловиром — совместное исследование. J. Pediatr. 101 , 622–625 (1982). Это первая демонстрация успешной противовирусной терапии для защиты детей с ослабленным иммунитетом от ветряной оспы.

    CAS Статья PubMed PubMed Central Google ученый

  • 173

    Уоллес, М.Р., Боулер, В. А., Мюррей, Н. Б., Бродайн, С. К. и Олдфилд, Е. С. Лечение ветряной оспы у взрослых пероральным ацикловиром. Рандомизированное плацебо-контролируемое исследование. Ann. Междунар. Med. 117 , 358–363 (1992).

    CAS Статья PubMed PubMed Central Google ученый

  • 174

    Бальфур, Х. Х. и др. . Контролируемое испытание ацикловира при ветряной оспе с оценкой времени начала и продолжительности терапии, а также устойчивости к вирусам. Pediatr. Заразить. Дис. J. 20 , 919–926 (2001).

    Артикул PubMed PubMed Central Google ученый

  • 175

    Sauerbrei, A. & Wutzler, P. Инфекции, вызванные вирусом простого герпеса и ветряной оспы во время беременности: современные концепции профилактики, диагностики и лечения. Часть 2: Инфекции, вызванные вирусом ветряной оспы. Med. Microbiol. Иммунол. 196 , 95–102 (2007).

    CAS Статья PubMed PubMed Central Google ученый

  • 176

    Дэвис, Х.Д. и др. . Инвазивные стрептококковые инфекции группы А в Онтарио, Канада. Группа A по изучению стрептококков Онтарио. N. Engl. J. Med. 335 , 547–554 (1996).

    CAS Статья PubMed PubMed Central Google ученый

  • 177

    Филлипс, У. Г., Марсден, Дж. Р. и Хилл, Ф. Г. Purpura fulminans из-за дефицита протеина S после ветряной оспы. Br. J. Dermatol. 127 , 30–32 (1992).

    CAS Статья PubMed PubMed Central Google ученый

  • 178

    Science, M. и др. . Осложнения центральной нервной системы, вызванные вирусом ветряной оспы. J. Pediatr. 165 , 779–785 (2014).

    Артикул PubMed PubMed Central Google ученый

  • 179

    Коэн Дж. И. Клиническая практика: опоясывающий лишай. Н.Англ. J. Med. 369 , 255–263 (2013).

    CAS Статья PubMed PubMed Central Google ученый

  • 180

    Дворкин Р. Х. и др. . Рекомендации по лечению опоясывающего герпеса. Clin. Заразить. Дис. 44 (Дополнение 1), S1 – S26 (2007).

    CAS Статья PubMed PubMed Central Google ученый

  • 181

    Макдональд, Э.M., de Kock, J. & Ram, F. S. F. Противовирусные препараты для лечения опоясывающего герпеса, включая офтальмический: систематический обзор высококачественных рандомизированных контролируемых исследований. Антивирь. Ther. 17 , 255–264 (2012).

    CAS Статья PubMed PubMed Central Google ученый

  • 182

    Тайринг, С. К., Бейтнер, К. Р., Такер, Б. А., Андерсон, В. К. и Крукс, Р. Дж. Противовирусная терапия опоясывающего герпеса: рандомизированное контролируемое клиническое испытание терапии валацикловиром и фамцикловиром у иммунокомпетентных пациентов 50 лет и старше. Arch. Fam. Med. 9 , 863–869 (2000).

    CAS Статья PubMed PubMed Central Google ученый

  • 183

    Лин, W. R. и др. . Сравнительное исследование эффективности и безопасности валацикловира по сравнению с ацикловиром при лечении опоясывающего герпеса. J. Microbiol. Иммунол. Заразить. 34 , 138–142 (2001).

    CAS PubMed PubMed Central Google ученый

  • 184

    Уитли Р.J. и др. . Ацикловир с преднизоном и без него для лечения опоясывающего герпеса. Рандомизированное плацебо-контролируемое исследование. Группа совместных противовирусных исследований Национального института аллергии и инфекционных заболеваний. Ann. Междунар. Med. 125 , 376–383 (1996).

    CAS Статья PubMed PubMed Central Google ученый

  • 185

    Хан, Ю. и др. . Кортикостероиды для профилактики постгерпетической невралгии. Кокрановская база данных Syst. Ред. 3 , CD005582 (2013).

    Google ученый

  • 186

    Дворкин Р. Х. и др. . Рандомизированное плацебо-контролируемое исследование оксикодона и габапентина при острой боли при опоясывающем герпесе. Боль 142 , 209–217 (2009).

    CAS Статья PubMed PubMed Central Google ученый

  • 187

    Северсон, Э.А., Барац, К. Х., Ходж, Д. О. и Берк, Дж. П. Офтальмологический опоясывающий герпес в округе Олмстед, штат Миннесота: повлияли ли системные противовирусные препараты? Arch. Офтальмол. 121 , 386–390 (2003).

    Артикул PubMed PubMed Central Google ученый

  • 188

    Гилрон, И. и др. . Нортриптилин и габапентин, по отдельности и в комбинации при нейропатической боли: двойное слепое рандомизированное контролируемое перекрестное исследование. Ланцет 374 , 1252–1261 (2009).

    CAS Статья Google ученый

  • 189

    Макникол, Э. Д., Мидбари, А. и Айзенберг, Э. Опиоиды при невропатической боли. Кокрановская база данных Syst. Ред. 8 , CD006146 (2013).

    Google ученый

  • 190

    Брунелл, П. А., Тейлор-Видеман, Дж., Гейзер, К. Ф., Фриерсон, Л. и Лидик, Э.Риск опоясывающего лишая у детей с лейкемией: вакцина против ветряной оспы по сравнению с ветряной оспой в анамнезе. Педиатрия 77 , 53–56 (1986).

    CAS PubMed PubMed Central Google ученый

  • 191

    Civen, R. et al. . Заболеваемость и клиническая характеристика опоясывающего герпеса у детей и подростков после вакцинации против ветряной оспы. Pediatr. Заразить. Дис. J. 28 , 954–959 (2009).

    Артикул PubMed PubMed Central Google ученый

  • 192

    Coplan, P. M. и др. . Разработка меры бремени боли из-за опоясывающего герпеса и постгерпетической невралгии для профилактических испытаний: адаптация краткого перечня болей. Дж. Пейн 5 , 344–356 (2004).

    Артикул PubMed PubMed Central Google ученый

  • 193

    Орведаль, А.И Левин, Б. Вирусное уклонение от аутофагии. Аутофагия 4 , 280–285 (2008).

    CAS Статья PubMed PubMed Central Google ученый

  • 194

    Карпентер, Дж. Э., Джексон, В., Бенетти, Л. и Гроуз, С. Формирование аутофагосом во время инфицирования вирусом ветряной оспы после стресса эндоплазматического ретикулума и развернутого белкового ответа. J. Virol. 85 , 9414–9424 (2011).

    CAS Статья PubMed PubMed Central Google ученый

  • 195

    Buckingham, E. M. и др. . Аутофагический поток без блока позволяет дифференцировать инфекцию, вызванную вирусом ветряной оспы, от инфекции, вызванной вирусом простого герпеса. Proc. Natl Acad. Sci. США 112 , 256–261 (2015).

    CAS Статья PubMed PubMed Central Google ученый

  • 196

    Дэвисон, А.Дж. И Скотт, Дж. Э. Полная последовательность ДНК вируса ветряной оспы. J. Gen. Virol. 67 , 1759–1816 (1986). В этой статье представлена ​​первая полная последовательность ДНК VZV.

    CAS Статья PubMed PubMed Central Google ученый

  • 197

    МакГеоч Д. Дж., Риксон Ф. Дж. И Дэвисон А. Дж. Темы геномики и эволюции герпесвирусов. Virus Res. 117 , 90–104 (2006).

    CAS Статья PubMed PubMed Central Google ученый

  • 198

    Гроуз, К. Пангея и модель эволюции вируса ветряной оспы и опоясывающего лишая за пределами Африки и филогеография. J. Virol. 86 , 9558–9565 (2012).

    CAS Статья PubMed PubMed Central Google ученый

  • 199

    Кодзима, Э. и др. . Функция GADD34 заключается в восстановлении после отключения синтеза белка, вызванного стрессом ER: выяснение у мышей с дефицитом GADD34. FASEB J. 17 , 1573–1575 (2003).

    CAS Статья PubMed PubMed Central Google ученый

  • 200

    Рави В., Кеннеди П. Г. и Маклин А. Р. Функциональный анализ гена RL1 штамма вируса простого герпеса 2 типа HG52: интрон не играет роли в вирулентности. J. Gen. Virol. 79 , 1613–1617 (1998).

    CAS Статья PubMed PubMed Central Google ученый

  • 201

    Перелыгина, Л. и др. . Полная последовательность и сравнительный анализ генома вируса герпеса B ( Cercopithecine herpesvirus 1 ) макаки-резуса. J. Virol. 77 , 6167–6177 (2003).

    CAS Статья PubMed PubMed Central Google ученый

  • 202

    Гроуз К. и Гиллер Р. Х. Инфекция вируса ветряной оспы и иммунизация здорового и иммунодефицитного хозяина. Crit. Преподобный Онкол. Гематол. 8 , 27–64 (1988).

    CAS Статья PubMed PubMed Central Google ученый

  • 203

    Холгейт, С. Т. Врожденные и адаптивные иммунные ответы при астме. Нац. Med. 18 , 673–683 (2012).

    CAS Статья PubMed PubMed Central Google ученый

  • 204

    Ким, Б.-S. и др. . Повышенный риск опоясывающего лишая у детей с астмой: популяционное исследование случай – контроль. J. Pediatr. 163 , 816–821 (2013).

    Артикул PubMed PubMed Central Google ученый

  • 205

    Эстебан-Васалло, доктор медицины, Домингес-Берхон, М. Ф., Хиль-Прието, Р., Астрай-Мочалес, Дж. И Хиль де Мигель, А. Социально-демографические характеристики и хронические заболевания как факторы риска опоясывающего герпеса: популяционное исследование первичной медико-санитарной помощи в Мадриде (Испания). Hum. Вакцин. Immunother. 10 , 1650–1660 (2014).

    Артикул PubMed PubMed Central Google ученый

  • 206

    Straus, S. E. Клинические и биологические различия между рецидивирующими вирусами простого герпеса и вирусами ветряной оспы. JAMA 262 , 3455–3458 (1989).

    CAS Статья PubMed PubMed Central Google ученый

  • 207

    Веллер Т.Х. и Стоддард, М. Б. Внутриядерные тельца включения в культурах тканей человека, инокулированных жидкостью везикул ветряной оспы. J. Immunol. 68 , 311–319 (1952). В этом исследовании VZV был впервые выделен в культуре клеток, что имело решающее значение для возможной разработки вакцины.

    CAS PubMed PubMed Central Google ученый

  • 208

    Веллер Т. Х. Серийное размножение in vitro агентов, продуцирующих тельца включения, полученные из ветряной оспы и опоясывающего герпеса. Proc. Soc. Exp. Биол. Med. 83 , 340–346 (1953).

    CAS Статья PubMed PubMed Central Google ученый

  • 209

    Центры по контролю и профилактике заболеваний (CDC). Сводка болезней, подлежащих уведомлению: США, 2009 г. MMWR Morb. Смертный. Wkly Rep. 58 , 1–100 (2011).

    Google ученый

  • 210

    Зербони, Л., Сен, Н., Оливер, С. Л., Арвин, А. М. Молекулярные механизмы патогенеза вируса ветряной оспы. Нац. Rev. Microbiol. 12 , 197–210 (2014).

    CAS Статья PubMed PubMed Central Google ученый

  • 211

    Де Клерк, Э. Стратегии разработки противовирусных препаратов. Нац. Rev. Drug Discov. 1 , 13–25 (2002).

    CAS Статья PubMed PubMed Central Google ученый

  • Вирусный менингит | Фонд исследования менингита

    Что вызывает вирусный менингит?

    Менингит может вызывать множество различных вирусов.Большинство людей контактируют с некоторыми из них в течение жизни без развития менингита. Наиболее частые причины:

    Энтеровирусы

    Энтеровирусы группы Коксаки или эховируса являются наиболее частой причиной вирусного менингита. Большинство инфекций протекают бессимптомно или имеют легкие симптомы, такие как ангина, простуда и гриппоподобные заболевания. Некоторые из них также могут вызывать расстройство желудка и диарею.

    Энтеровирусы чаще всего поражают детей, которые являются основными переносчиками этих вирусов.

    Энтеровирусные инфекции распространены в Великобритании в летние и осенние месяцы. Передается в основном из рук в рот.

    Вирусы герпеса

    Вирусы герпеса — еще одна частая причина вирусного менингита у подростков и взрослых в развитых странах [2]. К вирусам герпеса относятся вирусы простого герпеса (ВПГ) и вирус ветряной оспы — тот же вирус, который вызывает ветряную оспу и опоясывающий лишай.

    HSV могут вызывать менингит или энцефалит (воспаление самого мозга, что гораздо серьезнее).ВПГ-энцефалит в основном вызывается ВПГ-1 (который также является причиной большинства герпесов), тогда как менингит чаще вызывается ВПГ-2 (чаще является причиной генитального герпеса). Вирусы HSV были связаны с рецидивирующим лимфоцитарным менингитом, также известным как менингит Молларета. Он характеризуется внезапными приступами симптомов менингита, которые обычно длятся 2-7 дней и разделены бессимптомными интервалами, длящимися неделями, месяцами или годами.

    Инфекции HSV-1 и -2 очень распространены, но у большинства людей наблюдаются лишь незначительные симптомы или симптомы отсутствуют вообще.Передача происходит через контакт с инфицированным участком кожи, когда вирус активен. ВПГ-1 обычно передается орально в детстве, и около 6 из 10 человек в Великобритании переносят его. ВПГ-2 — это прежде всего инфекция, передающаяся половым путем, и ее переносит примерно каждый десятый житель Великобритании [3]. Многие люди заражаются вирусом простого герпеса, даже не подозревая об этом. Поскольку они могут передавать вирус, не проявляя симптомов, инфекция может неосознанно передаваться контактирующим. Время передачи непредсказуемо, поэтому генитальная герпетическая инфекция (и герпетический менингит) может появиться даже после многих лет моногамных отношений.

    Менингит, вызванный вирусом VZV, может возникать одновременно с ветряной оспой или опоясывающим лишаем или может возникать сам по себе без сыпи или кожных проявлений.

    Другие вирусы герпеса являются менее частыми причинами менингита по сравнению с вирусами простого герпеса и вирусом герпеса.

    Свинка и корь

    До того, как появилась вакцина MMR, эпидемический паротит был наиболее частой причиной вирусного менингита в Великобритании и встречался у 15% пациентов с эпидемическим паротитом [4]. Недавнее возобновление случаев заболевания в Великобритании в основном затронуло подростков и молодых людей, которые не прошли полный курс вакцины против кори, паротита и краснухи [1].Корь также может вызывать менингит и энцефалит.

    Флавивирусы

    Эти вирусы обычно поражают диких животных, таких как птицы или грызуны, и переносятся комарами или клещами. Некоторые из этих вирусов, такие как вирус Западного Нила, японский энцефалит B и клещевой энцефалит, могут вызывать менингит или энцефалит у людей, но это не проблема в Великобритании и Ирландии.

    Вирус иммунодефицита человека (ВИЧ) может вызывать менингит на ранних стадиях ВИЧ-инфекции.В случае вирусного менингита не всегда можно определить тип вируса, вызывающего заболевание (примерно у 30-40% пациентов патоген не идентифицирован). Хотя ВИЧ является редкой причиной вирусного менингита, важно, чтобы взрослые с вирусным менингитом по неизвестной причине прошли тест на ВИЧ. Это связано с тем, что вирусный менингит может быть первым признаком заражения ВИЧ, и если он не выявлен на этой ранней стадии, он может оставаться бессимптомным и недиагностированным до тех пор, пока у человека не разовьется прогрессирующая болезнь или СПИД.Есть надежда, что путем скрининга таких случаев будет выявлено больше людей с ВИЧ и начнется их лечение на ранней стадии, что приведет к лучшим результатам.

    Как лечится вирусный менингит?

    Ацикловир можно использовать для лечения инфекции HSV. Однако не существует эффективных методов лечения большинства вирусов, вызывающих менингит (антибиотики неэффективны против вирусов), поэтому лечение обычно ограничивается ослаблением симптомов заболевания (например, обезболивающие от головной боли или противорвотные средства, чтобы остановить рвоту).Большинство людей выздоравливают без какого-либо лечения в течение от 5 дней до двух недель, но у некоторых период выздоровления длится дольше.

    Врач может сделать люмбальную пункцию. Это когда образец спинномозговой жидкости (CSF) берется из спинномозгового канала (проход через кости спины, в котором находится спинной мозг). Образец спинномозговой жидкости будет исследован, а затем отправлен на дальнейшие лабораторные исследования. Люмбальная пункция важна для подтверждения диагноза менингита и выявления микроба, вызывающего заболевание.

    Какие последствия может вызвать вирусный менингит?

    Большинство людей выздоравливают без каких-либо заметных эффектов, однако недавние исследования показали, что у некоторых пациентов с вирусным менингитом может развиться кратковременная потеря памяти и дефицит внимания [5-6]. Есть также некоторые свидетельства того, что у детей с вирусным менингитом в возрасте до 1 года могут развиваться тонкие неврологические проблемы в более позднем возрасте [7].

    Подвержен ли я риску распространения или заражения этой болезнью, если я контактировал с пациентом с вирусным менингитом?

    Риск контакта очень низкий.Вирусный менингит обычно не требует принятия мер общественного здравоохранения, потому что, хотя некоторые из вирусов, вызывающих его, заразны, у большинства инфицированных людей симптомы отсутствуют или проявляются в очень легкой форме. Человек с вирусным менингитом может передать вирус, но очень маловероятно, что это может вызвать у другого человека также вирусный менингит.

    Можно ли предотвратить вирусный менингит?

    Большинство причин вирусного менингита нельзя предотвратить, хотя хорошей общей мерой предосторожности против вирусного менингита является мытье рук, поскольку энтеровирусы, в частности, обычно проникают в организм через «руки в рот».Иммунизация против эпидемического паротита и кори (MMR) предлагается детям в возрасте от 12 до 13 месяцев и в возрасте 3 лет в рамках плановой иммунизации детей. Иммунизация также доступна для некоторых флавивирусов, таких как клещевой энцефалит и японский энцефалит, и рекомендуется для путешественников в районы, где риск этих инфекций высок.

    Обнаружение энтеровируса, простого герпеса, ветряной оспы, эпштейна-Барра и цитомегаловируса в спинномозговой жидкости у пациентов с менингитом в Иране — Таваколиан — 2021 — Журнал клинического лабораторного анализа

    1 ВВЕДЕНИЕ

    Несмотря на достижения медицины, заболевания центральной нервной системы (ЦНС) пагубно сказываются на системе здравоохранения.Ряд факторов риска, особенно инфекционные агенты, могут вызывать воспаление паренхимы головного мозга и различные типы неврологических симптомов, называемых менингитом. 1-4 Менингит — одно из опасных для жизни заболеваний, приводящих к функциональной недостаточности мозга. Предыдущие исследования показали, что инфекционные агенты могут играть важную роль в прогрессировании менингита, поражая более 1,2 миллиона случаев ежегодно. 5-7 Среди различных типов инфекций большое внимание уделяется роли семейств вирусов, особенно Herpesviridae .Это семейство вирусов может быть ответственным за разрушение гематоэнцефалического барьера (ГЭБ) и некроз ткани головного мозга. По крайней мере, пять членов группы Herpesviridae , включая CMV, EBV, HSV-1, HSV-2 и VZV, которые распространяются по всему миру, могут вызывать онкогенную трансформацию и сверхэкспрессию гена. 8 Наиболее частыми клиническими симптомами пациентов, страдающих этими вирусными проблемами со здоровьем, являются волдыри, лихорадка, менингит, изменения в поведении человека, когнитивные нарушения, афазия, судороги и нейропсихологический дефицит. 9, 10 Люди с ослабленным иммунитетом, такие как пациенты со СПИДом и реципиенты трансплантатов, обычно имеют эти симптомы, поскольку эти вирусы являются условно-патогенными микроорганизмами 11, 12 Более того, Энтеровирус ( EV) — еще один вирус, который можно рассматривать одна из ведущих причин асептического менингита у детей. 13-15 Этот вирус, на который приходится 60–80% всех случаев асептического менингита, принадлежит к группе Picornaviridae . 16 EV Инфекции вызывают широкий спектр симптомов, таких как плеоцитоз (увеличение количества лимфоцитов в спинномозговой жидкости). 17 Поскольку вирусы, вероятно, являются причиной большинства случаев менингита, их диагностика может сократить количество назначений антибиотиков. 18 В свете вышеизложенного мы попытались исследовать распространенность этих вирусных заболеваний в спинномозговой жидкости пациентов, страдающих менингитом.

    2 МАТЕРИАЛЫ И МЕТОДЫ

    2.1 Пробоподготовка

    Настоящее исследование финансируется «Исследовательским центром инфекционных болезней и тропической медицины, Университет медицинских наук Шахида Бехешти, Тегеран, Иран» (IR.SBMU.RETECH.REC.1397.697, грант № 15259). В этом поперечном исследовании мы собрали сто два образца от пациентов (в возрасте от 1 месяца до 55 лет), страдающих потерей сознания, судорогами, мышечной слабостью, лихорадкой, головной болью, сыпью и внезапной тяжелой деменцией. из больниц Эмама Хоссина, Логмана и Мофида в период с ноября 2018 г. по сентябрь 2019 г. В этом исследовании поясничная пункция была выполнена тремя экспертами для анализа характеристик спинномозговой жидкости, включая лейкоциты, глюкозу, белок и микробиологические свойства.(Таблица 1) Все образцы хранили при -20 ° C.

    ТАБЛИЦА 1. Демографические данные и лабораторные данные по VZV-инфицированным пациентам и всем детям с подозрением на менингит
    Среднее значение (диапазон) или Нет (%) ВЗВ положительный ВПГ-1 положительный EBV положительный
    Мужской 2 2 3
    Женский 0 4 2
    Лихорадка 38 ℃ 38.3 ℃ 37,9 ℃
    Головная боль 2 1 1
    Тошнота или рвота 2 0 1
    Изъятие 0 2 2
    Сыпь 1 1 0
    Количество CSF-WBC (0–21 200) / мм 3 1567 1675 1932
    Количество CSF-RBC (0–85) / мм 3 5.4 5,2 5,4
    CSF-белок (5–670) мг / дл 107,5 152,1 135
    ЦСЖ-глокус (10–80) мг / дл 48.8 53,3 49,1
    СРБ в сыворотке (1–149) мг / дл 44 65 52

    2.2 Экстракция нуклеиновых кислот

    РНК и ДНК отфильтрованного CSF экстрагировали с помощью набора High Pure Viral Nucleic Acid Kit (Roche Diagnostics), в котором 200 мкл отфильтрованного образца CSF элюировали 50 мкл элюции в соответствии с протоколом производителя.

    2.3 Синтез кДНК

    В этом исследовании мы использовали набор кДНК Bio fact. После объединения 25 мкл элюированных очищенных вирусных нуклеиновых кислот с 24 мкл обратной транскриптазы и 1 мкл гексамера Random, инкубацию проводили в течение 40 минут при 50 ° C и 10 минут при 95 ° C в Bio Intellectica PCR.Затем кДНК дважды разбавляли стерильной водой.

    2,4 ПЦР гена GAPDH

    Ген β ‑ глобина

    был использован для оценки качества выделения ДНК. Смешивали 12,5 мкл мастер-смеси, 1 мкл прямого праймера (10 пмоль), 1 мкл обратного праймера (10 пмоль), 1 мкл ДНК и 8,5 мкл стерильной воды в конечных 25 мкл. Смесь инкубировали по следующему графику ПЦР: 5 минут при 95 ° C в качестве первой денатурации, 30 циклов 95 ° C в течение 30 секунд, 55 ° C в течение 30 секунд, 72 ° C в течение 30 секунд и 72 ° C в течение 7 минут.Конечная продукция ПЦР составляла около 100 пар оснований, и каждый положительный образец оценивался для выявления HSV-1, HSV-2, CMV, VZV, EBV и EV.

    2,5 Вложенная ПЦР для EV

    В этом исследовании мы оценили распространенность ЭВ с помощью вложенной ПЦР. На первом этапе смешивали 12,5 мкл основной смеси для ПЦР, 1 мкл прямого праймера, 1 мкл обратного праймера (таблица 2), 5 мкл ДНК и 5,5 мкл стерильной воды. Первый график ПЦР: начальная денатурация в течение 3 минут при 94 ° C, 40 циклов денатурации при 94 ° C в течение 30 секунд, отжиг при 44 ° C в течение 30 секунд, удлинение при 72 ° C в течение 30 секунд и окончательное удлинение при 72 ° C в течение 5 мин.Затем на втором этапе смешивали 12,5 мкл мастер-смеси, 1 мкл прямого праймера, 1 мкл обратного праймера, 8,5 мкл стерильной воды и 2 мкл ДНК первых продуктов ПЦР. График ПЦР был следующим: начальная денатурация 3 мин при 94 ° C, 40 циклов денатурации при 94 0 C в течение 30 с, отжиг при 51 0 C в течение 30 с, удлинение при 72 ° C в течение 30 с, и окончательное удлинение при 72 ° C в течение 5 мин. Второй продукт ПЦР был примерно 360 мкл и подвергался электрофорезу в 2% агарозном геле.

    ТАБЛИЦА 2.Праймеры мультиплексной ПЦР, ПЦР и вложенной ПЦР
    PCR-HSV1-F GACTCTCCCACCGCCATCAG
    ПЦР-HSV1-R TGTCTTCGGGCGACTGGTCT
    ПЦР-HSV2-F TATGCCTATCCCCGGTTGGA
    ПЦР — HSV2-R CGTGCCATCCGAATAAACGTG
    PCR-VZV-F TTGTGTCGGTCTCTCCAAGC
    PCR-VZV-R TACGTCTTCAACCTCACGCC
    PCR-CMV-F TGGCTTTTCTTGAACGTGCG
    PCR-CMV-R CCTTGACGCTGGTTTGGTTG
    EBNA F TGAATACCACCAAGAAGGTG
    EBNA R AGTTCCTTCGTCGGTAGTC
    GAPDH F ATGTTCGTCATGGGTGTGAA
    GAPDH R GGTGCTAAGCAGTTGGTGGT
    224-F (вложенная ПЦР, первая стадия) GCIATGYTIGGIACICAYRT
    222 (вложенная ПЦР, первая стадия) CICCIGGIGGIAYRWACAT
    AN89 (вложенная ПЦР, второй этап) CCAGCACTGACAGCAGYNGARAYNGG
    AN88-F (вложенная ПЦР, второй этап) TACTGGACCACCTGGNGGNAYRWACAT

    2.6 Мультиплексная ПЦР и ПЦР

    Мультиплексная ПЦР использовалась для исследования распространенности VZV, HSV-1 и HSV-2 в образцах спинномозговой жидкости. 25 мкл мастер-смеси объединяли с 18 мкл стерильной дистиллированной воды, 4 мкл ДНК-матрицы, 0,5 мкл прямого и 0,5 мкл обратного праймеров HSV-1, HSV-2, VZV (1,5 мкл прямого праймера и 1,5 мкл обратного праймера), в конечном итоге. 50 мкл. Схема мультиплексной ПЦР была следующей: начальная денатурация при 95 ° C в течение 2 минут, затем 40 циклов при 95 ° C в течение 30 секунд, 58 ° C в течение 40 секунд и 72 ° C в течение 1 минуты и 15 секунд, с последующим продлением. при 72 ° C в течение 10 мин.

    Кроме того, для обнаружения ВЭБ и ЦМВ использовались 2 протокола ПЦР. 12,5 мкл мастер-смеси, 6,5 мкл стерильной дистиллированной воды, 4 мкл матрицы ДНК, 1 мкл прямого и 1 мкл обратного праймеров (таблица 2) были смешаны и инкубированы на начальной стадии денатурации при 95 ° C в течение 2 минут с последующими 40 циклами при 95 ° C в течение 30 с, 55 ° C в течение 60 с и 72 ° C в течение 1 мин и 15 с, с последним продлением при 72 ° C в течение 10 мин. (Рисунок 1.)

    (A) Конечная продукция ПЦР для HSV-1 составила 269 п.н.Гликопротеин gG рассматривался как положительный контроль (B). Продукция ПЦР для CMV составляла 716 п.н., и мы использовали гликопротеин gB в качестве положительного контроля. (C) Продукция ПЦР EBV составляла 390 п.н. (D) Конечная продукция ПЦР VZV составляла 934 п.н., и Гликопротеин gB был выбран в качестве положительного контроля

    2.7 Молекулярное клонирование

    На этом этапе последовательности ДНК были амплифицированы, и гликопротеин gB, гликопротеин gG и гликопротеин gB были закодированы для обнаружения CMV, HSV-1,2, VZV соответственно.Действительно, после субклонирования этих генов в Escherichia coli ( штамм BL21 ) мы использовали их в качестве положительного контроля.

    2,8 Статистический анализ

    Результаты, полученные в настоящем исследовании, были проанализированы, чтобы найти корреляцию между распространенностью VZV, HSV-1, EBV и полом и возрастом пациента с помощью статистического программного обеспечения IBM SPSS версии 22 и теста хи-квадрат. Более того, тест ANOVA использовался для подтверждения связи между возрастом и инфекциями VZV, HSV-1, EBV.Экспериментальные данные выражали как среднее значение ± стандартное отклонение трех независимых анализов. p -значение меньше чем ( p <0,05) использовалось для различий.

    3 РЕЗУЛЬТАТЫ

    Сто два пациента (53 мужчины и 49 женщин) с симптомами, включая лихорадку, тошноту, головную боль, сыпь, были отобраны для оценки распространенности EV, CMV, EBV, HSV-1, HSV-2 и VZV с помощью вложенной ПЦР, ПЦР и мультиплексная ПЦР. Клинические данные этих пациентов, госпитализированных в больницы Emam Hossin, Loghman и Mofid, показали бактериальные инфекции почти в 30% образцов.Большинство пациентов составляли дети до 18 лет; один месяц и менее ( n = 15), 1–12 месяцев ( n = 37), 1–7 лет ( n = 10), 7–18 лет ( n = 17) и более старше 18 лет ( n = 23). Более чем в 35% и 20% случаев наблюдались тошнота или рвота и судороги соответственно. Головная боль отмечалась у 32,4% пациентов; однако температура тела у 66,7% пациентов составляла 38 ° C, и только у 5,9% наблюдались сыпь и головокружение. Среднее количество лейкоцитов в спинномозговой жидкости составило 5520 / мкл (от 0 до 21 200), а среднее количество эритроцитов из спинномозговой жидкости было 2.1 / мкл (от 0 до 85,0). Более того, уровни белка и глюкозы в спинномозговой жидкости составляли 91 мг / дл (от 5 до 878) и 47 мг / дл (от 3 до 116) соответственно. У большинства пациентов сыворотка показала высокие уровни CRP (в среднем 36 мг / дл; в диапазоне от 1 до 149).

    Наши результаты показали, что 6, 5 и 2 образца (7 мужчин и 6 женщин) были инфицированы HSV-1, EBV и VZV соответственно. Средний возраст этих пациентов составлял 11 месяцев, и у всех наблюдалась лихорадка. У пациентов, страдающих VZV, сообщалось о головной боли и тошноте или рвоте, а у одного из них была сыпь.(Таблица 1).

    4 ОБСУЖДЕНИЕ

    Заболевания центральной нервной системы (ЦНС) можно считать одной из ведущих причин смерти во всем мире. Статистика показывает, что менингит является причиной 0,6% всех смертей, а выжившие обычно страдают различными видами инвалидности. 19 Существует ряд тесных взаимосвязей между различными факторами риска и расстройствами центральной нервной системы, но роль вирусных инфекций привлекает большое внимание. 13, 20-22 Поскольку симптомы этого заболевания неспецифичны, для выявления возбудителей необходим молекулярный анализ. 23, 24 В этом исследовании изучали распространенность Herpesviridae и Picornaviridae в спинномозговой жидкости пациентов, страдающих менингитом.

    В этом исследовании мы обнаружили 6, 5 и 2 образца, инфицированных HSV-1, EBV и VZV, соответственно, но мы не обнаружили ДНК CMV и HSV-2. Это исследование подтвердило результаты предыдущих исследований, в которых сообщается, что распространенность этих вирусов зависит от множества факторов, особенно от места исследования и возраста пациента.Например, в Финляндии с 1999 по 2003 год 26% и 8% пациентов были инфицированы EV и VZV, соответственно; однако 17% от общего числа образцов и 25% женщин показали инфекции HSV-2. 25 Другое исследование, проведенное в 2017 году в Турции, показало, что распространенность HSV1, HSV2, CMV, EBV, VZV, HHV6 и EV составила 1,80% (24/1333), 0,08% (1/1333), 3,28%. (19/580), 4,35% (22/506), 0,46% (1/216), 1,05% (5/478) и 3,37% (6/178) соответственно. 26 ДНК ВПГ-1 у 351 пациента (70.8%), ДНК ВПГ-2 в 83 образцах (16,7%) и неопределенный тип ДНК ВПГ у 62 пациентов (12,5%) были идентифицированы с помощью ПЦР-анализа. 27 Подчеркивая важность анализа ПЦР, Smith и др. Сообщили о 2 пациентах с менингоэнцефалитом, вызванным HSV-1. 28 После анализа 21 пациента с острым бактериальным менингитом в Швеции ни один из образцов спинномозговой жидкости не показал ДНК HSV-1, HSV-2, VZV, EBV и HHV-6. 29 У пациентов, у которых не было волдырей или сыпи, вируса герпеса (HHV) были обнаружены у 12 (6.9%) образцы спинномозговой жидкости (6,3% в случаях клещевого энцефалита, 7,8% у людей, страдающих энтеровирусным менингитом и 1 (0,9%) в контрольной группе). Кроме того, общий белок в ДНК-положительных образцах HHV был выше, чем в HHV-отрицательных образцах. единицы. 30 Мультиплексная ПЦР выявила инфекции EV, VZV и HSV-1 в 26, 4 и 2 случаях из 140 включенных пациентов, соответственно, но свинка и ДНК HSV-2 не были обнаружены. 31 В Украине среди 107 пациентов с некоторыми клиническими признаками, включая лихорадку, ригидность шеи и очаговые неврологические признаки, ВПГ-1 и 2 в (12.1%), VZV у (1,8%), CMV у (13%), EBV у (20,5%), HSV-6 у (4,7%), HSV-7 у (12,1%) и коинфекции (≥ 2 HV) в 35,5% случаев. 32 В другом исследовании были обнаружены 21 образец с положительным результатом ВПГ-1 и 74 ВПГ-2 (у большинства пациентов с ВПГ-1 был энцефалит, а у ряда инфицированных ВПГ-2 был менингит. 33 В 2011 г. Paticheep S. и др. обнаружили ЭВ в 1,67% своих образцов, 34 , но Bastos MS и др. обнаружили ЭВ в 16 из 49 образцов спинномозговой жидкости (16/49; 32,6%).В другом исследовании результаты EV-PCR показали, что сто тридцать семь пациентов (49,6%) были EV-положительными. 35

    Наряду с географическим распределением и годом исследования, на прогрессирование менингита могут повлиять и другие факторы, в том числе возраст, пол, метод обнаружения и размер выборки. Ограничением этого исследования было небольшое количество образцов. Более того, в этом исследовании большинство образцов было взято у пациентов в возрасте до 18 лет.Метод — еще одна проблема, которую следует тщательно рассмотреть, и нашими методами были ПЦР, вложенная ПЦР и мультиплексная ПЦР. 36-38 В свете вышеизложенного, распространенность HSV 1 , EBV и VZV высока в Иране и может играть ключевую роль в прогрессировании менингита, требуя немедленного обнаружение и лечение.

    5 ОГРАНИЧЕНИЕ

    Ограничением этого исследования было небольшое количество образцов.

    6 УТВЕРЖДЕНИЕ ЭТИКИ И СОГЛАСИЕ НА УЧАСТИЕ

    Настоящее исследование финансируется «Исследовательским центром инфекционных болезней и тропической медицины, Университет медицинских наук Шахида Бехешти, Тегеран, Иран» (IR.SBMU.RETECH.REC.1397.697, грант № 15259).

    7 СОГЛАСИЕ НА ПУБЛИКАЦИЮ

    Не применимо.

    ПОДТВЕРЖДЕНИЕ

    Не применимо.

      КОНФЛИКТЫ ИНТЕРЕСОВ

      Авторы заявляют об отсутствии конфликта интересов.

      ВЗНОС АВТОРОВ

      E.F., I.A и SH.T разработали исследование и провели молекулярные эксперименты. Компания H.G выполнила статистический анализ. Все авторы прочитали и одобрили окончательную версию рукописи.

      Все данные, полученные или проанализированные в ходе этого исследования, включены в эту опубликованную статью.

      ССЫЛКИ